Labshake search
Citations for Illumina :
3351 - 3400 of 10000+ citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... DNA PCR free libraries were sequenced on paired-end 150 pb runs on the NovaSeq6000 (Illumina) apparatus ...
-
bioRxiv - Genomics 2023Quote: ... Bisulfite converted DNA was then put through the standard Infinium HD array based methylation assay (Illumina) with Illumina Infinium HumanMethylation EPIC BeadChips ...
-
bioRxiv - Cancer Biology 2022Quote: ... The overlapping set of DNA methylation probes between the external validation cohort (Illumina Methylation 450K array) and the 2000 differentially methylated probes from the discovery cohort (Illumina MethylationEPIC 850K array ...
-
bioRxiv - Immunology 2023Quote: Isolated phage DNA was sequenced at the Naval Medical Research Center using MiSeq (2×300bp) (Illumina). Whole genome assembly was performed using SPAdes and CLCBio genome workbench ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and IDT for Illumina – TruSeq® DNA UD Indexes v1 (Illumina Inc., San Diego, CA, USA). The libraries were pooled and sequenced with a paired-end 150 bp strategy on two Illumina NovaSeq 6000 S4 flowcells for 1.3 T of paired-end raw read data each ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Neuroscience 2023Quote: ... the tagmented DNA was amplified using Illumina primers (NEBNext® Multiplex Oligos for Illumina, NEB #7335S) with the following cycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... Nextera indices were added to purified DNA fragments per the manufacturer’s protocol (Illumina, San Diego, CA). The indexed fragments were purified using AMPure XP Beads according to the manufacturer’s protocol (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... Library preparation was performed according to Illumina’s TruSeq DNA Sample Preparation Guide (Illumina, San Diego, CA). Single-end sequence reads of approximately 50 bp were obtained ...
-
bioRxiv - Molecular Biology 2023Quote: ... SSDS libraries were amplified during 15 cycles of PCR using TruSeq DNA Nano LP (Illumina, 20016328), purified with AMPureXP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries were prepared with the Illumina TruSeq DNA Protocol (Illumina Inc., San Diego, CA, United States) and targeted fragments were sequenced with V4 chemistry in paired-end 150-bp mode on an Illumina HiSeq 2500 (Illumina Inc. ...
-
bioRxiv - Microbiology 2024Quote: ... The adjusted DNA was purified and then sequenced using a next-generation sequencer (MiSeq, Illumina Inc.) to produce the library ...
-
bioRxiv - Genomics 2024Quote: ... DNA was sheared into smaller fragments and sequenced on the NovaSeq 6000 platform (Illumina, CA, USA) to generate 151 bp paired-end (PE ...
-
bioRxiv - Genomics 2024Quote: ... Salivary DNA from ADHD patients and controls was genotyped using the Infinium Global Screening Array (Illumina), as previously described ...
-
bioRxiv - Immunology 2021Quote: ... High-quality RNA was processed using an Illumina TruSeq RNA sample prep kit v2 or TruSeq Small RNA Sample Prep kit following the manufacturer’s instructions (Illumina). Clusters were generated using TruSeq Single-Read Cluster Gen ...
-
bioRxiv - Neuroscience 2020Quote: ... and sequenced on an Illumina HiSeq 2500 using HiSeq SBS kit v4 250 cycle kit (Illumina, FC-401-4003). A standard Illumina pipeline was used to generate fastq files ...
-
bioRxiv - Systems Biology 2021Quote: ... we used the KAPA RNA HyperPrep Kit with RiboErase prep combined with KAPA Unique Dual-Indexed Adapter Kit (Illumina), starting from 650 ng RNA ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing was performed using an Illumina NextSeq500 platform and NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kits (Illumina). Each specimen was tested in two technical replicates ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were generated with the Chromium Single Cell ATAC Library & Gel Bead Kit (1000111) and sequenced using the NextSeq 500/550 High Output Kit v2.5 (Illumina) on an Illumina NextSeq 550 platform ...
-
bioRxiv - Plant Biology 2021Quote: ... Pre-Release Protocol Rev.A with TruSeq RNA Sample Prep Kit and TruSeq Small RNA Sample Prep Kit (Illumina Inc.). The library was reverse transcribed ...
-
bioRxiv - Physiology 2022Quote: ... Libraries were prepared according to the manufacturer’s instructions using Chromium Single Cell 3’ Library & Gel Bead Kit v2 (10X Genomics) and sequenced on the Illumina NextSeq 500 using High Output Kit v2.5 (150 cycles, Illumina) for 26 bp + 98 bp paired-end reads with 8bp single index aiming raw sequencing depth of >20,000 reads per cell for each sample.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Georgia Institute of Technology) using the HiSeq Rapid PE Cluster Kit v2 and HiSeq Rapid SBS Kit v2 (Illumina) for 300 cycles (2 x 150 bp paired end) ...
-
bioRxiv - Genomics 2021Quote: Sequencing libraries were generated using the sequencing kit: TruSeq SBS Kit v5 – GA (36 Cycle) (FC- 104-5001, Illumina). Samples were then sequenced on an Illumina GA-IIx sequencer using paired-end (PE ...
-
bioRxiv - Immunology 2021Quote: ... or S2 Reagent Kit (100, 200, or 500 cycles) or TG NextSeq 500/550 High Output Kit v2.5 (150 cycles) (Illumina). An average of 179 million reads was generated per sample.
-
bioRxiv - Microbiology 2022Quote: We sequenced the pooled sample containing PCR products using Illumina MiSeq technology (Illumina Reagent Kit v2, 500 reaction kit) at the Center for Bioinformatics and Genomics at Indiana University ...
-
bioRxiv - Genetics 2022Quote: ... Normalised DNA libraries were clustered on Illumina cBot then sequenced using Illumina HiSeq X Ten platform using HiSeq X Ten Reagent Kit v2.5 kits (FC-501-2501, Illumina). Paired end sequencing was performed using the 2×150bp chemistry to achieve an average output of approximately >120 Gb of data per library.
-
bioRxiv - Microbiology 2024Quote: ... Libraries were sequenced with a Nextseq 2×150 pb paired-end reagent kit (NextSeq 500/550 High Output Kit v2.5, Illumina) on an Illumina Nextseq500 sequencer ...
-
bioRxiv - Genomics 2023Quote: NGS libraries from DRIP DNA and inputs were constructed according to the manufacturer’s instructions (KAPA Hyper Prep Kit: Roche, cat. no. #KK8502 kit and single- indexed adapters from Illumina, cat ...
-
bioRxiv - Genomics 2024Quote: ... and NP0550 on either a NextSeq 550 using a NextSeq 500/550 High Output v2.5 75 cycle kit or on a NextSeq 2000 using a NextSeq 1000/2000 P3 50 cycle kit (Illumina).
-
bioRxiv - Evolutionary Biology 2024Quote: ... The cDNA libraries were constructed with either the kits TruSeq v2 or Scriptseq v2 RNA Library Prep kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... with 100-bp single-end reads using a TruSeq SR Cluster Kit v3-cBot-HS and TruSeq SBS Kit v3-HS (Illumina). Sequenced reads were processed using an Illumina standard base-calling pipeline (v1.8.2) ...
-
bioRxiv - Developmental Biology 2020Quote: ... with a Hiseq PE Rapid Cluster Kit v2-HS and Hiseq Rapid SBS Kit v2-HS (200 Cycle) on a Hiseq2500 (Illumina) was performed following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sequencing pool was adjusted to a final concentration of 11.5 pM (for V2 kits) or 18 pM (for V3 kits) and sequenced in a MiSeq system (Illumina, USA), using the standard Illumina primers provided by the manufacturer kit ...
-
bioRxiv - Cell Biology 2022Quote: ... libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Kit (cat. RS-122-2201/2202, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sample libraries were subsequently pooled and loaded to the HiSeq2500 and sequenced using a Hiseq rapid SRcluster kit and HiSeq rapid SBS kit (Illumina). Single 50bp reads were generated for the bioinformatic analysis ...
-
bioRxiv - Neuroscience 2019Quote: ... Cluster generation was performed with the resulting libraries using the Illumina TruSeq PE Cluster Kit v4 reagents and sequenced on the Illumina HiSeq 2500 using TruSeq SBS Kit v4 reagents (Illumina). Sequencing data were demultiplexed using the bcl2fastq Conversion Software (version 2.20 ...
-
bioRxiv - Genetics 2021Quote: ... The toRNA-seq and mRNA-seq libraries were generated using the Illumina TruSeq Stranded Total RNA kit and Stranded mRNA kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... was performed on the instrument using HiSeq Rapid SBS Kit v2 (FC-402-4021) and HiSeq Rapid PE Cluster Kit v2 (PE-402-4002) (Illumina). Image analysis was performed using the HiSeq Control Software version 2.2.58 ...
-
bioRxiv - Cell Biology 2021Quote: ... Total 500 ng RNA processed for library preparation using “TruSeq” RNA sample preparation-V2 kit and “Ribo-Zero” rRNA removal kit (Illumina) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... plate-based RNA sample prep was performed on the PerkinElmer Sciclone NGS robotic liquid handling system using Illumina Ribo-Zero rRNA Removal Kit (Bacteria) and the TruSeq Stranded Total RNA HT sample prep kit following the protocol outlined by Illumina in their user guide ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... and sequenced using MiSeq sequencing platform with MiSeq Reagent kit v3 (2 × 300 bp mode with the 600 cycle kit) (Illumina).
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Immunology 2020Quote: ... using NextSeq 500/550 v2.5 sequencing reagent kit (read length: 2 × 75 bp) or NovaSeq S1 sequencing reagent kit (read length: 2 × 100 bp) (Illumina) respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... The remaining batch was prepared with the TruSeq RNA Exome sample prep kit (formerly the TruSeq RNA Access sample prep kit; Illumina). All libraries were randomly pooled to multiplex 24 samples per lane using Illumina TruSeq barcodes ...
-
bioRxiv - Immunology 2020Quote: ... Sequencing was performed in a high-throughput MiSeq machine using either a v2 Nano reagent kit 2×250bp or a v3 reagent kit 2×300bp (Illumina) at the Genomic Research Unit (GRU ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 150bp/150bp paired end run using the HiSeq Rapid SBS Kit v2 or NovaSeq 6000 SP/S1/S2/S4 Reagent Kit (100/200/300 cycles) (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... RNA was purified using QIAGEN RNeasy kit and ribosomal RNA was depleted using the Ribo-Zero rRNA removal magnetic kit (Illumina). The cDNA library was generated using the NEBNext Ultra II RNA Library Prep Kit and each replicate was barcoded in the DNA library using the NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... ScRNA-seq libraries were prepared using the Next GEM Chromium single cell 3′ reagent kits V3.1 with feature barcode technology for cell surface protein (10x genomics) and sequenced using NextSeq 500 high output kits and Novaseq S4 PE100 kits (Illumina). scRNA-Seq data after standard quality control was aligned to the reference genome (mm10 ...