Labshake search
Citations for Illumina :
3301 - 3350 of 10000+ citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: Genomic DNA material was used for the preparation of two standard TrueSeq Illumina libraries (Illumina Inc) with an average size of 360 and 747 bp ...
-
bioRxiv - Neuroscience 2021Quote: ... Then the tagmented DNA was indexed and amplified with 3.75 µL of PCR master mix (Illumina) and 1.25 µL each of i5 and i7 indexing primers (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... high-quality DNA samples were subjected to dual-indexed Nextera XT Illumina library preparation (Illumina, USA), prior to cluster generation and paired-end short-read high throughput sequencing (2×150bp or 2×250bp ...
-
bioRxiv - Neuroscience 2020Quote: ... there were 421 subjects with both data of DNA methylation and RNA sequencing (RNA-seq) (Illumina) from their dorsolateral prefrontal cortex9 (Supplementary Methods) ...
-
bioRxiv - Neuroscience 2020Quote: ... and UMB797 were processed at New York Genome Center using TruSeq Nano DNA library preparation (Illumina) followed by Illumina HiSeq X Ten sequencing to a minimum 200× depth ...
-
bioRxiv - Microbiology 2021Quote: ... and the DNA library was sequenced on the Illumina MiSeq next generation sequencing system (Illumina Inc.) in paired end mode with 2 x 250 bp ...
-
bioRxiv - Microbiology 2022Quote: DNA was isolated from the overnight culture of SK431 and subjected to random sequencing by Illumina MiSeq as described [28] ...
-
bioRxiv - Genetics 2022Quote: ... were then subjected to validation using massive parallel amplicon sequencing (MPAS, AmpliSeq Illumina Custom DNA Panel), to orthogonally assess each mutation in sperm donors ...
-
bioRxiv - Cell Biology 2022Quote: Global DNA methylation was measured on 512 samples using the Illumina EPIC microarray (Illumina, San Diego). Arrays were run at the UCLA Neuroscience Genomic Core (UNGC) ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA library of each batch was sequenced using the MiSeq platform from Illumina (Illumina, USA) using the MiSeq reagent V2 500cycles Kit from Illumina and the custom read1 (TATGGTAATTGTGTGCCAGCMGCCGCGGTAA) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragmentation and Illumina P7 adaptor (CAAGCAGAAGACGGCATACGAGAT) ligation were performed in NeoPrep Library Prep System (Illumina). Transposon junctions were amplified by using a transposon specific primer Mariner_1R_TnSeq_noMm (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCGGGGACTTATCAGCCAACC ...
-
bioRxiv - Microbiology 2021Quote: ... genomic DNA from parental and mutant cell lines were sequenced by the HiSeq4000 sequence system (Illumina), generating about 10 million 100-bp reads and compared to that of the T ...
-
bioRxiv - Microbiology 2021Quote: ... Extracted genomic DNA were subjected to 16S rRNA gene metabarcoding analysis by Miseq (Illumina, CA, USA) at the Australian Centre for Ecogenomics (Bribane ...
-
bioRxiv - Microbiology 2022Quote: ... at speed 5.5)) and libraries for shotgun-sequencing were prepared (Illumina DNA Prep, Illumina, United States) that were subsequently sequenced on Illumina NovaSeq 6000 (at Helmholtz Centre for Infection Research (HZI) ...
-
bioRxiv - Microbiology 2022Quote: ... at speed 5.5)) and libraries for shotgun-sequencing were prepared (Illumina DNA Prep, Illumina, United States) that were subsequently sequenced on Illumina NovaSeq 6000 (at Helmholtz Centre for Infection Research (HZI) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Clones emitting light were selected for DNA sequencing verification of the entire plasmid (MiniSeq, Illumina, USA).
-
bioRxiv - Microbiology 2022Quote: ... The short-read sequencing library was prepared using the Illumina DNA Prep (Illumina, San Diego, CA), and the library was sequenced on an Illumina NovaSeq 6000 system with 250-bp paired-end sequencing (although we obtained Illumina reads for the isolates in our previous study (Gomi et al. ...
-
bioRxiv - Microbiology 2022Quote: Libraries were prepared using Nextera® or Truseq® DNA (Illumina, San Diego, CA, United States). Bacterial whole genome sequencing was conducted ...
-
bioRxiv - Cancer Biology 2022Quote: ... for the extraction of DNA methylation signals from scanned arrays (methylation module version 1.9.0, Illumina Inc.). Methylation data were extracted as raw signals with no background subtraction or data normalization ...
-
bioRxiv - Cancer Biology 2019Quote: ... The DNA library was loaded on an Illumina MiSeq instrument according to the manufacturer’s instructions (Illumina). Sequencing was performed with a 2 × 250bp paired-end configuration ...
-
bioRxiv - Genomics 2020Quote: ... The enriched DNA library fragments were subjected to sequencing in Illumina NextSeq 550 (Illumina, Inc., USA) using Illumina High Output Kit for NextSeq 500/550 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were then resuspended in 50 μl transposase reaction mix (1x Tagment DNA buffer (Illumina 15027866), 2.5 μl Tagment DNA enzyme I (Illumina 15027865) ...
-
bioRxiv - Microbiology 2021Quote: ... a quantity was used for DNA library preparation and sequencing process using Illumina machines (Illumina, USA) 24 ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA was purified and sequenced on an Illumina MiSeq benchtop sequencer (Illumina, San Diego, CA). Sequenced reads were mapped onto the N16961 V.cholerae reference genome ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DNA methylation was quantified using Infinium® Human Methylation 450K BeadChip (Illumina Inc.; San Diego, CA).
-
bioRxiv - Genomics 2020Quote: ... Genome-wide DNA methylation was assessed using the Illumina Infinium MethylationEPIC BeadChip (Illumina, San Diego, CA) at the University of Chicago Functional Genomics Facility (UC-FGF) ...
-
bioRxiv - Genomics 2020Quote: DNA methylation was assessed genome-wide from peripheral blood with commercial arrays from Illumina (CA, USA). The Infinium MethylationEPIC BeadChip ...
-
bioRxiv - Genomics 2021Quote: ... WGS libraries were prepared using the Nextera DNA Flex Library Prep according to the manufacturer’s (Illumina) instructions ...
-
bioRxiv - Genomics 2019Quote: ... DNA was diluted to 1 nM and prepared for paired-end sequencing on a MiniSeq (Illumina) using a 75 or 150-cycle kit according to the manufacturer’s instructions with a final loading concentration of 1.1 pM.
-
bioRxiv - Microbiology 2021Quote: ... DNA from all strains was extracted and sequenced using an Illumina HiSeq 2500 device (Illumina, USA). The isolation and sequencing procedure is described in detail elsewhere [14] ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ng of DNA was used to create Nextera XT libraries according to manufacturer’s instructions (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... DNA from each sample was diluted to 0.5ng/µl and tagmented with the Nextera enzyme (Illumina) for 10 min at 55°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... whereby the orientation and originating DNA strand of the RNA are maintained (Illumina Stranded RNA-Seq). Each library was uniquely indexed and then sized and quantified by capillary electrophoresis (TapeStation ...
-
bioRxiv - Genomics 2021Quote: ... Pelleted nuclei were resuspended in 50 µl transposase reaction mix (1x Tagment DNA buffer (Illumina 15027866), 2.5 µl Tagment DNA enzyme I (Illumina 15027865) ...
-
bioRxiv - Genetics 2020Quote: Adapter-ligated libraries were prepared from genomic DNA using the manufacturer’s protocol (Illumina, San Diego, CA) from PT3037 and the pooled suppressed F2s ...
-
bioRxiv - Cancer Biology 2022Quote: ... Resulting DNA libraries were pooled at 10 nM and sequenced in 2 × 76-bp format (Illumina), resulting in >35 million read pairs per library.
-
bioRxiv - Genomics 2022Quote: ... All DNA libraries were subjected to paired-end sequencing on the Illumina Hiseq 2000 platform (Illumina). Muscle samples were also collected for constructing RNA sequencing (RNA-seq ...
-
bioRxiv - Genomics 2022Quote: ... 10 units of T4 PNK (NEBNext® DNA Library Prep Master Mix Set for Illumina, #E6040L) were added to the blunt-ended DNA in NEBNext End Repair Reaction Buffer (NEB ...
-
bioRxiv - Genetics 2022Quote: DNA library preparation followed the manufacturer’s instructions (PE-402-4001, PE HiSeq 2500 Flow Cell, Illumina) as described previously (Wang et al. ...
-
bioRxiv - Microbiology 2022Quote: ... UNSW_1.7, UNSW_2.14 and UNSW_3.3 library preparation (FS DNA Library, NEBNext® Ultra™) and sequencing (Illumina HiSeq3000 ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were then resuspended in 50 μl transposase reaction mix (1x Tagment DNA buffer (Illumina, 15027866), 2.5 μl Tagment DNA enzyme I (Illumina ...
-
bioRxiv - Microbiology 2022Quote: Library preparation was performed on 30 samples with Nextera DNA Flex (Illumina, Inc.; San Diego, CA) (Figure 1B ...
-
bioRxiv - Microbiology 2023Quote: ... Nextera indices were added to purified DNA fragments per the manufacturer’s protocol (Illumina, San Diego, CA). The indexed fragments were purified using AMPure XP Beads according to the manufacturer’s protocol (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... following the Illumina Nextera XT DNA Library Preparation protocol (Cat. FC-131-1024, Illumina, CA, USA). For DNA tagmentation ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Prepared DNA has then been sequenced in paired-ends on our in-lab sequencer (iSeq100; Illumina).
-
bioRxiv - Bioengineering 2024Quote: ... To extract all DNA methylation beta values for the 102 nt BCAT1 promoter measured by Illumina EPIC array ...
-
bioRxiv - Immunology 2023Quote: ... we performed high-throughput DNA sequencing of the tagmented library on a NextSeq 500 System (Illumina) to generate paired-end ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the pooled DNA was sequenced by the Illumina Novaseq platform (100 bp paired-end; Illumina). For indel quantification ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA PCR free libraries were sequenced on paired-end 150 pb runs on the NovaSeq6000 (Illumina) apparatus ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA from parental and mutant cell lines were sequenced by the HiSeq4000 sequence system (Illumina), generating about 10 million 100-bp reads and compared to that of the T ...