Labshake search
Citations for Illumina :
251 - 300 of 8917 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Genomics 2020Quote: ... and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse GRCm38/mm10 genome annotation was accessed from Illumina’s iGenomes repository (available at https://support.illumina.com/sequencing/sequencing_software/igenome.html ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2020Quote: ... TruSeq SBS Kit v3-HS 50 cycles kit (Illumina).
-
bioRxiv - Cancer Biology 2019Quote: ... and TruSeq Stranded Total RNA Human/Mouse/Rat (Illumina, 20020596) with 100 ng of input and 13 PCR cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... Infinium Mouse Methylation BeadChip (Illumina, Inc., San Diego, CA, USA) arrays were used to profile DNA methylation genome wide ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Plant Biology 2023Quote: The prediction of protein-coding potential for transcripts generated from Illumina and SMRT data was conducted by integrating CPC2 v0.1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nextera XT Index Kit and Miseq Sequencing Kit (MiSeq Reagent Kits v2,300 cylce) were purchased from Illumina.
-
bioRxiv - Genomics 2022Quote: ... Tagmentation Kit (Illumina) following the Illumina reference guide instructions and recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation kit (Illumina). One ug of RNA was processed for each sample ...
-
bioRxiv - Genomics 2022Quote: ... kit (Illumina #20025523) by the University of Michigan Advanced Genomics Core ...
-
bioRxiv - Genetics 2023Quote: ... Ligation kit (Illumina), followed by 100 bp single-end sequencing on an Illumina NovaSeq 6000 SP system.
-
bioRxiv - Cell Biology 2022Quote: ... Ligation Kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and then aligned to the mouse genome using Top-Hat (Illumina) and fragments were assigned to genes using the FeatureCounts program (iCONICS core facility ...
-
bioRxiv - Neuroscience 2023Quote: ... using either the using NextSeq 500/550 High Output v2.5 (150 cycles) Kit or the NovaSeq 6000 S2 Reagent Kit v1.5 (100 cycles) Kit (Illumina). The Illumina raw BCL sequencing files were processed through the CellRanger software (10x Genomics ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 cycles of PCR for incorporation of unique dual indices (NEBNext multiplex oligos for Illumina) to the final libraries ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Both full-length and 3’ RNA- seq libraries were sequenced on a NextSeq 500 instrument (Illumina) with 5-10 x 106 aligned reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina) to perform the sequencing.
-
bioRxiv - Cell Biology 2019Quote: ... COX4I2 and 3’ end of ID1 (green fluorescently labelled BAC (RP5-857M17) provided by BlueGnome (Illumina)) and the 20q telomere probe the TelVysion 20q Spectrum Orange (Cat ...
-
bioRxiv - Genomics 2019Quote: ... The sequencing was conducted on the MiSeq reagent v.3 600 cycles (Illumina, San Diego, CA). The four genomes were assembled using ngs_mapper v1.5 ...
-
bioRxiv - Genomics 2021Quote: ... and dual-indexed 3’ digital gene expression (DGE) sequencing libraries were prepared using Nextera XT (Illumina). Libraries were sequenced on a NovaseqS4 or NovaseqS2 with a paired end read structure (R1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina) using a NovaSeq S1 flow-cell to a depth of at least 3.5 × 108 reads/timepoint.
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: scRNA-seq library preparation was performed using 10x Genomics Chromium 3’ single cell library protocol (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Developmental Biology 2023Quote: ... 3’ RNA-seq (Bulk MARS-seq91,135) libraries were prepared and sequenced on a Novaseq 6000 (Illumina) at the Weizmann Crown Institute for Genomics ...