Labshake search
Citations for Illumina :
151 - 200 of 8917 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2024Quote: ... Then the scRNA-seq libraries were constructed by using the Chromium Next GEM Single Cell 3’ Reagent Kits v3 (10X Genomics, USA) and sequenced by using the sequencer Novaseq6000 (Illumina, USA). All procedures were following the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2021Quote: ... 2 μg of total RNA were treated with the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat; Illumina). Depleted RNA was precipitated 1h at −80°C in three volumes of ethanol plus 1 μg of glycogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was depleted of ribosomal RNA using Ribo-Zero rRNA Removal Kit (Epicentre/Illumina, Human/Mouse/Rat) and library preparation was completed using NEBNext® Ultra Directional RNA Library Prep Kit for Illumina® (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina), following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA was removed from total RNA using the Ribo Zero Gold for human/mouse/rat kit (Illumina). Using the TruSeq RNA Sample Library Preparation v.2 kit (Illumina) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and depleted of rRNA using the Ribo-Zero Magnetic Kit HMN/Mouse/Rat 24 Rxn (Illumina; Cat# MRZH11124) according to the manufacturer’s protocol using a low input protocol with 2-4µL rRNA removal solution yielding a 20µL final sample volume added to 90µL magnetic beads ...
-
bioRxiv - Genomics 2023Quote: ... and stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina), following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were sequenced using an Illumina MiSeq with MiSeq Reagent Kit v.3 (2x 300 bp, Illumina, San Diego, CA, USA) according to manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-seq libraries were constructed using a QuantSeq 3’mRNA-Seq Library Prep Kit (LEXOGEN, Vienna, Austria) and sequenced with the NextSeq500 (Illumina, CA, USA) to generate a minimum of two million single-end 75-bp reads ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina and UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1) from Lexogen (015.96 and 081.96 ...
-
bioRxiv - Genomics 2019Quote: ... followed by the removal of ribosomal RNA using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Strand-specific sequencing libraries were prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... RNA sequencing libraries were made using the TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... For whole genome sequencing of mouse RNA a library was generated with Truseq Small RNA Library Preparation kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA- Seq library was prepared by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224) and TruSeq Stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... Ribosomal reduction libraries were prepared with the Ribo-Zero Gold rRNA removal kit (human/mouse/rat) MRZG12324 (Illumina, USA) and sequenced at the Yale University Center of Genome Analysis (YCGA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Depletion of ribosomal RNA was carried out solely by use of the RiboZero Gold Human/Mouse/Rat kit (Illumina). Adapter sequences were based on the TruSeq small RNA sequences (Illumina) ...
-
bioRxiv - Genomics 2022Quote: ... RNA-seq libraries were prepared from 600 ng of total RNA (RNA integrity number (RIN) >8.0) with TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina). For polysome immunoprecipitation experiments ...
-
A gene desert required for regulatory control of pleiotropic Shox2 expression and embryonic survivalbioRxiv - Developmental Biology 2023Quote: ... RNA-seq libraries were prepared using the TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Genomics 2020Quote: ... and libraries were constructed by the Lexogen QuantSeq 3’ mRNA-Seq Library Kit FWD (Lexogen, Vienna, Austria).19 All RNA libraries were sequenced by the Illumina HiSeq4000 (Illumina, San Diego, CA). Raw sequencing data were aligned to the reference genome (GRCh37 ...
-
bioRxiv - Genetics 2021Quote: ... Libraries constructed with the Lexogen QuantSeq 3′ mRNA-Seq Library Kit FWD (Lexogen, Greenland, NH) were sequenced on an Illumina NextSeq 500 (Illumina, San Diego, CA) at the Genomics Facility of the Cornell Institute of Biotechnology.
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Microbiology 2023Quote: ... second BsmBI site (producing cut-edge between the base pairing region and dCas9 handle binding region) and read2 (Illumina sequencing element) was amplified from pPEPZ-sgRNAclone (Addgene# 141090 ...
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA libraries were constructed from individual mouse samples and RNA-seq libraries were constructed using the Nextera XT DNA Library Preparation Kit (Illumina). Libraries were sequenced on the Illumina platform ...
-
bioRxiv - Developmental Biology 2020Quote: ... Ribosomal RNA was removed from 500ng of input RNA using either Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) from Illumina or NEBNext rRNA Depletion Kit (Human/ Mouse/ Rat) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-Seq libraries were made following a standard protocol using Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and TruSeq Stranded mRNA Library Prep (Illumina) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing libraries were generated using the TruSeq Stranded Total RNA with Ribo-Zero Human/ Mouse/Rat Low-throughput (LT) kit (Illumina) and run on a NextSeq 500 for paired-end sequencing using the NextSeq 500/550 High Output v2 Kit ...
-
bioRxiv - Genomics 2020Quote: Illumina sequencing libraries of total RNA were prepared using the Illumina TruSeq Stranded Total RNA Human/Mouse/Rat kit (Cat number RS-122-2201) following the protocol provided by Illumina with Ribo-Zero.
-
bioRxiv - Systems Biology 2019Quote: ... was measured using an Agilent Bioanalyzer and samples were ribo-depleted using a using a RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of input RNA was used for rRNA removal with Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Libraries were generated with the NEBNext Ultra Directional RNA Library Prep kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were prepared from 1 μg of total RNA using a TruSeq Stranded Total RNA Kit with Ribo-Zero Human/Mouse/Rat (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The eluted RNAs were ribodepleted by using the rRNA removal section of a TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina), with the supernatant from the magnetic-bead separation cleaned-up by using a Zymo RNA Clean & Concentrator kit with 8X ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-seq libraries were prepared using the TruSeq Stranded Total RNA LT Sample Prep Kit with Ribo-Zero Human/Mouse/Rat (Illumina). We generated biological triplicate data for 1T47 ...
-
bioRxiv - Genomics 2019Quote: ... cDNA libraries were constructed using Illumina TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Set B (Illumina) to deplete ribosomal RNA according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2019Quote: ... The Agilent 2100 Bioanalyzer was used to assess RNA quality and only high quality RNA (RIN > 8) was further processed for removal of ribosomal RNA with the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Illumina). Ribosomal-depleted RNA was used as input for library preparation with Illumina TruSeq V2 RNA prep kit and processed according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 ug of total RNA were processed for rRNA depletion by Ribozero Gold rRNA Removal kit (Human/Mouse/Rat) (Illumina) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg chromatin-associated RNAs were depleted of ribosomal RNA depletion using Ribo-Zero Magnetic Gold Kit (human/mouse/rat; Illumina), according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg chromatin-associated RNAs were depleted of ribosomal RNA depletion using Ribo-Zero Magnetic Gold Kit (human/mouse/rat; Illumina), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: ... rRNA was depleted using Ribo-Zero™ Magnetic Gold Kit for rRNA depletion (Human/Mouse/Rat) (Epicentre for Illumina #MRZG12324) according to manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... ribosomal RNA (rRNA) was depleted from the total RNA extracts using the Ribo-Zero Gold (human-mouse-rat) kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing libraries were generated using the TruSeq Stranded Total RNA with Ribo-Zero Human/ Mouse/Rat Low-throughput (LT) kit (Illumina) and run on a NextSeq 500 for paired-end sequencing using the NextSeq 500/550 High Output v2 Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Both samples (footprints and total mRNA) went through a ribosomal RNA removal step using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina). The footprint samples were then purified on a 15% TBE-Urea polyacrylamide gel (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... one microgram of total RNA was used to construct cDNA libraries with the TruSeq Stranded Total RNA with Ribo-Zero Gold Human/Mouse/Rat kit (Illumina). Sequencing was performed using Illumina NovaSeq 6000 (coverage - 50 x ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA was depleted from total RNA using the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Illumina, San Diego, CA) to enrich for coding RNA and long non-coding RNA ...