Labshake search
Citations for Illumina :
251 - 300 of 528 citations for Acetaldehyde 3a 4 5 6 7 7a hexahydro 4 7 methano 1H inden 5 yl oxy since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... approximately 5×104 cells were lysed and transposed reactions were carried out using Tn5 Transposase (Illumina, #FC121-1030) at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Systems Biology 2022Quote: ... were lysed and transposed simultaneously in 25 µl of transposition mix (0.1% NP40, 0.1% Tween-20, 0.01% digitonin and 5% Tn5 enzyme (Illumina # 15027865) in Tagment DNA Buffer (FC-121–1030 ...
-
bioRxiv - Microbiology 2023Quote: ... Fastq files for 5′ libraries sequenced with the extended R1 strategy were generated using bcl2fastq v2.20.0 (Illumina, Inc). Extended R1 fastqs were then separated into “pseudo R1” fastqs ...
-
bioRxiv - Cell Biology 2024Quote: ... The amplified DNA was then pooled to a 10 nM final concentration followed by a 5% PhiX (Illumina) spike and sequenced in a PE100 run on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... 5 PCR-cycles for the addition of indexes) according to manufacturer’s instructions (Illumina, Inc., San Diego, CA, USA). The final library pool was quantified by qPCR (Mascher et al ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were then sequenced with a depth of 5 million of reads using a NextSeq 500 System (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... The captured libraries were sequenced to achieve a mean unique coverage of at least 1000x using Illumina v.4 chemistry and paired-end 100-base pair (bp) reads (HiSeq, Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... The flow cell underwent cluster amplification and massively parallel sequencing by synthesis using Illumina v.4 chemistry and paired-end 100-bp reads (Illumina).
-
bioRxiv - Immunology 2021Quote: Paired-end RNA-Sequencing was performed on two independent biological replicates of 10 or 12 pooled 4-dpf larval zebrafish per genotypic group (nlrc3l mutants versus their siblings) by Illumina HiSeq 2×100 basepairs ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 4 pools were sequenced on the Illumina MiSeq using the 600-cycle MiSeq Reagent Kit V3 (Illumina). Each pool contained 3 identical samples to assess sequencing run variations.
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Microbiology 2020Quote: ... Libraries diluted to 4 nM were sequenced with NextSeq 500 High Output Kit v2 (75 cycles) on a NextSeq 500 (Illumina). Small RNA libraries have been submitted to the NCBI sequence read archive (SRA ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were then collected by centrifuging at 500 x g for 10 min at 4°C and nuclei were resuspended in 50 μL of transposition reaction mix [25 μL 2X TD buffer (Illumina), 16.5 μL PBS ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... 4 μg of total RNA from A549 cells was subjected to rRNA removal using the Ribo-Zero Gold kit (Illumina). cDNA sequencing libraries were then prepared using the SureSelect Strand-Specific RNA library preparation kit (Agilent Technologies ...
-
bioRxiv - Genomics 2020Quote: ... The normalised samples (4 nM) were denatured with 0.2 N NaOH and diluted 20 pM using pre-chilled Hybridisation Buffer (HT1) (Illumina, USA). The 20 pM transcriptome libraries were further diluted to 10 pM with pre-chilled HT1 buffer prior to whole transcriptome sequencing on a MiSeq platform.
-
bioRxiv - Genomics 2021Quote: Final samples for both inverse PCR and UMI-amplicons (concentration 4 nM) were sequenced as paired-end reads on HiSeq2500 and NextSeq500 sequencers (Illumina).
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).
-
bioRxiv - Genomics 2023Quote: ... Lysate was centrifuged for 10 min at 500g at 4°C and then resuspended in transposition buffer (25 ul TD buffer and 2.5 ul TD enzyme (Illumina, 20034197), 16.5 ul PBS ...
-
bioRxiv - Immunology 2024Quote: ... After centrifugation at 500ξ g for 5min at 4°C, the cell pellets were resuspended in tagmentation-mix (containing Tagment DNA buffer, Tagment DNA Enzyme (Illumina), Digitonin (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... stage-matched comparisons comprising a total of 5 control and 4 Mesp1 KO embryos were ultimately re-pooled and sequenced together for deep sequencing on a NovaSeq6000 S4 lane (Illumina). All libraries were sequenced to depths of at least 24,000 median fragments per cell ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each pool was sequenced 100 bp single-end on two flow cells of a HiSeq2500 sequencer using the HiSeq SBS sequencing kit version 4 (Illumina). Sequencing was conducted in two separate HiSeq runs to yield enough coverage per sample and later combined ...
-
bioRxiv - Genomics 2022Quote: ... We centrifuged at 500 x g for 10 minutes at 4°C and resuspended cells in the transposition reaction mix (25 µL 2X TD buffer (Illumina), 2.5 µL TDE1 Tn5 transposase (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was collected for 4 biological replicates within each cell line and libraries were prepared by TruSeq mRNA Library Prep (Illumina). The libraries were sequenced on the Illumina HiSeq 4000 platform ...
-
bioRxiv - Molecular Biology 2024Quote: ... and finally diluted to 1.5 pM before loading at a low cluster density (4 x 105 clusters / mm2) together with 50% of PhiX spike-in (Illumina). For libraries sequenced on NextSeq extra purification and removal of adapter dimers was performed using SPRIselect beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... were pelleted at 500 g for 10 minutes at 4°C in a fixed angle centrifuge and resuspended in 50 μL transposition buffer (prepared from Illumina kit components TD buffer and 100 nM transposase [Illumina] ...
-
bioRxiv - Neuroscience 2024Quote: ... were pelleted at 500 g for 10 minutes at 4°C in a fixed angle centrifuge and resuspended in 50 μL transposition buffer (prepared from Illumina kit components TD buffer and 100 nM transposase (Illumina) ...
-
bioRxiv - Genomics 2022Quote: ... The libraries prepared were sequenced using the FLO-MIN106 (R9.4) flowcells on PromethION 24 (P24) Nanopore platform and following the paired-end sequencing workflow of Illumina HiSeq2000 platform (Illumina, USA) (Supplementary Method).
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were pelleted (500xg, 10 min, 4 °C) and tagmented with the Nextera DNA Library Prep Kit (Illumina, FC-121-1030) for 1 h at 37 °C ...
-
bioRxiv - Zoology 2020Quote: ... or 70 bp (Exp#4) RNA sequencing (RNAseq) was performed on Illumina HiSeq 2000 platform (Illumina, Inc., San Diego, CA, USA) from libraries construed as has been described in previous report (Zhang et al. ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-10 ng of the full-length cDNA was used as input for preparing Nextera XT (Illumina, cat. # FC-131-1024) libraries following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The 16S rRNA gene V3-V4 regions were amplified (4) followed by addition of Illumina sequencing barcoded adaptors (Illumina, CA, USA.). The libraries were normalized and pooled for multiplex sequencing using the Illumina MiSeq v3 600 cycles cartridge (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... A total of 4 µg of RNA per sample was subjected to rRNA depletion using the RiboZero Plant Leaf kit (Illumina, MRZPL1224) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA input ranging from 64.4 ng – 1000 ng was used to initiate the Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Illumina 20040525) library preparation ...
-
bioRxiv - Genomics 2023Quote: ... A total of 4 µg of RNA per sample was subjected to rRNA depletion using the RiboZero Plant Leaf kit (Illumina, MRZPL1224) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
bioRxiv - Immunology 2024Quote: ... One library consisting of a total of 4 samples were pooled and sequenced on the NextSeq 2000 (Illumina, San Diego, CA) using a P3 100 cycle kit (Illumina) ...
-
bioRxiv - Genetics 2024Quote: ... and feature barcoding libraries were pooled at a 4:1:1 ratio and treated with Illumina Free Adapter Blocking Reagent (Illumina, #20024144). Sequencing of pooled libraries was carried out on a NextSeq 2000 sequencer (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...