Labshake search
Citations for Illumina :
151 - 200 of 528 citations for Acetaldehyde 3a 4 5 6 7 7a hexahydro 4 7 methano 1H inden 5 yl oxy since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... cell lysates were treated with 5 units RNaseI (ART-Seq, Epicenter/Illumina) per OD260 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL each of Nextera XT Index primers i5 and i7 (Illumina), 7 µL molecular grade water (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... All CORALL generated libraries were sequenced in parallel on 4 Novaseq S4 lanes (Illumina). RNA sequencing libraries for the differential sedimentation speed based cell fractionation experiment were performed using QuantSeq 3’ mRNA-Seq kit (Lexogen ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were diluted to 4 nM and sequenced on a NextSeq 500 sequencer (Illumina) with a NextSeq 500 High-Output Kit v2 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were multiplexed and sequenced on 4 lanes of a Nextseq 500 sequencer (Illumina) with 3 sequencing runs ...
-
bioRxiv - Genomics 2023Quote: ... The transposition reaction was incubated for 30 min or 1h at 37◦C (Illumina Tagment DNA Enzyme and Buffer kit ...
-
bioRxiv - Immunology 2020Quote: ... The 5’gene expression libraries were sequenced in NextSeq or NovaSeq6000 sequencer (Illumina) using NextSeq 500/550 v2.5 sequencing reagent kit (read length ...
-
bioRxiv - Immunology 2021Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... 5 µl nuclease and 2.5 µl Tn5 transposase enzyme (TDE1, Illumina, catalog # 15027865) and incubated for 28 minutes at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... the 5’ Illumina adapter (as used in the Illumina TruSeq Small RNA kit) and a split 2x 3 nt Unique Molecular Identifier (UMI ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli transposition assays were mixed with 5 µL of tagmentation DNA buffer (Illumina) and 1 µL of amplicon tagmentation mix (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... with a loading sample concentration of 10pM and a 5% PhiX (Illumina, U.S.) spike-in ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pellet was resuspended in transposition solution containing 5 μL TDE1 (Illumina, 15027865) 25 μL 2x buffer (Illumina ...
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Microbiology 2023Quote: ... a 4 nM library was sequenced on the Illumina Nextseq500 platform (Illumina, San Diego, CA) at the Radboudumc sequencing facility ...
-
bioRxiv - Systems Biology 2023Quote: ... allowing 4 lanes of 10x to be sequenced per NovaSeq S1 flow cell (Illumina #20028319) using a 28bp read 1 ...
-
bioRxiv - Genomics 2022Quote: ... Libraries depleted of ribosomal RNA (figure 2 and 3A-B) were constructed with the TruSeq Total RNA with Ribo Zero plant Kit (Illumina, San Diego, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were sequenced using the llumina NextSeq 550 platform with 5% PhiX (Illumina) spike-in ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing of 5’ gene expression libraries was performed on an Illumina NextSeq 2000 (Illumina) using P3 reagent kits (100 cycles) ...
-
bioRxiv - Cancer Biology 2024Quote: ATAC-seq was conducted on 5 × 104 live cells using Nextera Tn5 transposase (Illumina) as previously described 31 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced on an Illumina HiSeq 2000 sequencer (RRID:SCR_020132, v.4, Illumina, San Diego, California, USA) in 50 bp single-end mode by Genomics and Proteomics Core facility ...
-
bioRxiv - Microbiology 2022Quote: ... and diluted to 4 nM for sequencing on an Illumina MiSeq (Illumina, San Diego, CA, USA). A 500 cycle MiSeq Reagent kit v2 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in cleavage mix (MiSeq Nano kit v2 reagent 4) (Illumina MS-103-1003) for 6 min at 60 °C ...
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2024Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1,6 pM of libraries with 5% PhiX was then loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Genomics 2020Quote: ... denatured and diluted to 4 pM before loading onto the MiSeq flow cell (Illumina Inc., United States). According to Illumina protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclei were then pelleted (1,000xg, 10min, 4°C) and transposed in 2.5µl Tn5 (Nextera Tn5 transposase, Illumina), 12.5µl TD reaction buffer and 10.5µl water for 40min at 37°C with rotation ...
-
bioRxiv - Genomics 2020Quote: ... The library was sequenced on 4 lanes of an Illumina HiSeq 1500 (Illumina Inc.; San Diego, CA), generating 450,132,548 reads which were subsequently trimmed to remove adapters and filtered for length and quality using FASTX-Toolkit v0.0.14 (available from http://hannonlab.cshl.edu/fastx_toolkit/) ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were diluted to 4 nM and sequenced on a NextSeq 500 Sequencing System (Illumina, California, USA) using NextSeq 500/550 High Output Kit v2 (150 cycles ...
-
bioRxiv - Genomics 2021Quote: ... The library pool was sequenced on all 4 lanes of an NovaSeq 6000 S4 flow cell (Illumina) for 150 bp paired end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Immunology 2023Quote: ... We observed less than 4% barcode swapping between the two barcodes (more than 96% of the Illumina sequencing reads contained correct endodomain and barcode pairs) ...