Labshake search
Citations for Illumina :
251 - 300 of 814 citations for 3 1 Phenylethylamino propane 1 thiol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 10% v/v dimethylformamide) containing 1 μl Tagment DNA Enzyme (Nextera DNA Sample Prep Kit (Illumina)) ...
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... and samples were sequenced as 1 × 86 bp single-end reads on the NextSeq500 (Illumina, US), yielding on average 42 M reads per sample ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced at Novogene on 1 HiSeq PE 150 lane (6 bp, i7 single index, Illumina). The output of the lane was 375 million reads.
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of total RNA was processed by Ribo-Zero Magnetic Kit (Bacteria) (#MRZB12424, Illumina, USA). Resulting rRNA-depleted mRNA was phosphorylated by T4 polynucleotide kinase (#M0201 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single read 1 x 50 bp sequencing of these libraries was performed in HiSeq-2500 (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... libraries were prepared using Index Primer Set 1 (NEBNext Multiplex Oligos for Illumina, E7335L, Lot 10172541), Ultra II FS DNA Library Prep Kit for Illumina (E7805L ...
-
bioRxiv - Microbiology 2024Quote: ... A library was prepared independently with 1 μg of total RNA for each sample by Illumina TruSeq Stranded mRNA Sample Prep Kit (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were then prepared from 1 ng cDNA using the Nextera XT DNA Library Kit (Illumina). Libraries were sequenced (> 2.107 reads/library ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... rRNA was removed from 1 μg of total RNA using Ribo-Zero(TM) rRNA Removal Kit (Illumina). Stranded cDNA libraries were generated using the Illumina Truseq Stranded mRNA Library Prep kit ...
-
bioRxiv - Genetics 2020Quote: ... Sequencing libraries were generated from total RNA (1 ug) using the TruSeq stranded mRNA kit (Illumina Corp.) and were sequenced using a NovaSeq6000 S4 ...
-
bioRxiv - Genomics 2020Quote: Paired-end sequencing libraries (Additional Table 1) were prepared using the TruSeq DNA Sample Prep kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... All libraries were diluted to 1 nM and pooled for further sequencing on the MiniSeq platform (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... Libraries generated with indexing version 134 (Supplementary Table 1) were sequenced on a HiSeq2500 sequencer (RRID:SCR_016383, Illumina) using custom sequencing primers ...
-
bioRxiv - Biochemistry 2020Quote: ... we reduced the false-positive reads introduced by library generation and sequencing steps (Illumina reported at 1%). We detected and discarded on average 5% of reads due to false-positive mutations ...
-
bioRxiv - Microbiology 2022Quote: ... diluted at a ratio of 1:2 and amplified following the Nextera XT Index protocol (Illumina, Inc.). The amplicons were normalized using a SequalPrep™ Normalization Plate Kit (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Microbiology 2020Quote: ... cultures (Supplementary Table 1) using the Epicentre MasterPure DNA Purification kit (Illumina Biotechnology, San Diego, CA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The libraries were PE150 sequenced on either HiSeqX (Liver nuclei batch 1) or a NovaSeq 6000 (Illumina). scnmC-Seq2 libraries were prepared according to the previously published protocol (Luo et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 ng of pre-amplified cDNA from an estimated 600 cells was tagmented by Nextera XT (Illumina) with a custom P5 primer (Integrated DNA Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... rRNA depletion was conducted with 1 μg total RNA using Ribo-Zero rRNA Removal Kit Bacteria (Illumina), followed by library preparation with NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... and libraries prepared using the NexteraXT kit and sequenced using HiSeq 1 × 150-cycle v3 kit (Illumina). The operational taxonomic unit (OTU ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 µg of total RNA was used as input for the TruSeq sRNA Library Preparation kit (Illumina) as described in the TruSeq RNA Sample Preparation v2 Guide (Illumina) ...
-
Autocrine Sfrp1 inhibits lung fibroblast invasion during transition to injury induced myofibroblastsbioRxiv - Cell Biology 2022Quote: ... 1 ng of pre-amplified cDNA from an estimated 1000 cells was tagmented by Nextera XT (Illumina) with a custom P5-primer (Integrated DNA Technologies) ...
-
bioRxiv - Immunology 2024Quote: ... Beads were resuspended in 29 µL pre-warmed tagmentation buffer with 1 µL Tn5 transpose (Illumina, 20034197). Samples were incubated for 5 minutes with vigorous mixing at 1100 rpm at 37°C in a thermomixer ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA eluted and purified was sequenced (sequencing single-reads, 1 × 50 bp or paired-end 100bp; Illumina) of the resulting input and IP samples performed by BGI ...
-
Transcriptional dissection of symptomatic profiles across the brain of men and women with depressionbioRxiv - Neuroscience 2023Quote: ... RNA libraries were synthesized from 1 μg of RNA using the ScriptSeq Complete Gold Kit (Epicentre, Illumina) including an initial ribosomal RNA depletion step ...
-
bioRxiv - Neuroscience 2023Quote: ... Single read (1×75bp) sequencing was performed on the NextSeq 550 platform (Illumina Inc, SY-415-1002) using the NextSeq 500/550 High-Output v2.5 kit (20024906) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The quantified library pool was diluted to 1 nM and sequenced on MiniSeq (Illumina, FC-420-1001) to check for the quality of reads ...
-
bioRxiv - Cancer Biology 2023Quote: ... Fixed cells were transposed using barcoded Tn5 (Seqwell) in a transposition buffer (1 × TD buffer from Illumina Nextera kit ...
-
bioRxiv - Genomics 2023Quote: ... and used 1 ng for DNA library preparation using the Nextera XT DNA Library Preparation kit (Illumina), according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... and the indexed libraries were prepared from 1 μg of purified RNA with TruSeq-stranded mRNA (Illumina) Library Prep Kit according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared from 1 μg of RNA using the TruSeq Stranded mRNA library prep kit (Illumina) following the reference guide ...
-
bioRxiv - Genomics 2023Quote: ... The libraries were then subjected to 1×75bp high-throughput sequencing using a NextSeq 500 instrument (Illumina). Reads were mapped to the Arabidopsis TAIR10 reference genome using STAR version 2.7.2b (32) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 ng of genomic DNA was used for constructing sequencing libraries with the NexteraXT Kit (Illumina). MagSi-NGSPREP Plus Beads (Steinbrenner Laborsysteme GmbH ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10% dimethylformamide) and 1 μl Tagment DNA Enzyme from the Nextera DNA Sample Prep Kit (Illumina #20034198) and incubated at 37°C for 10 min in a thermomixer ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA-seq libraries were constructed with 1-5μg of RNA using a TruSeq Stranded mRNA kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: Library 1 was sequenced in-house on a NextSeq 500/550 Mid Output kit (150 cycles, Illumina) with custom primers (Oligos 9 and 10) ...
-
bioRxiv - Bioengineering 2024Quote: ... libraries were generated from 1 mg of genomic DNA using the TruSeq DNA Sample Preparation Kit (Illumina), and sequenced on the HiSeq 4000 system (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 cycles of PCR for incorporation of unique dual indices (NEBNext multiplex oligos for Illumina) to the final libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... Both libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD from Illumina, following the standard protocol ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Both full-length and 3’ RNA- seq libraries were sequenced on a NextSeq 500 instrument (Illumina) with 5-10 x 106 aligned reads per sample ...