Labshake search
Citations for Illumina :
51 - 100 of 814 citations for 3 1 Phenylethylamino propane 1 thiol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... A total of 56 samples (Appendix 1) were sequenced together on one lane of 1×75bp NextSeq500 High Output (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sequence data were first converted into fastq format using bcl2fastq v2.17.1.14 with the following parameters --use-bases-mask=Y150,I13,I12,Y150 --minimum-trimmed-read-length=1 --mask-short-adapter-reads=1 --create-fastq-for-index-reads (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... using single end 63bp for Read 1 and 12bp for index 1 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were run on an Illumina Nextseq 550 instrument using the MetSeq Primer 1 (NuGEN) mixed with the Read 1 primer (Illumina) according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified PCR products were pooled 1:1 and a 5% PhiX DNA spike-in was included and sequenced by Illumina HiSeq PE150 platform at Novogene ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2021Quote: ... 12 assemblies were done: 1) baseline (Illumina only), 2 ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL 12.5 μM Nextera Ad1 primer (Illumina), 1 μL 12.5 μM Nextera Ad2 barcoded primer (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 µL of amplicon tagmentation mix (Illumina) in a final volume of 10 µL and incubated at 55 °C for 7 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Read 1 was read with primer HP6 (Illumina) with 3 dark cycles (first 3 bases of read 1 were not read) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries with 1 % spiked-in PhiX control (Illumina) were sequenced at the 75-bp paired end on a high output flow cell using an Illumina NextSeq550 instrument at a sequencing depth of ∼1 M reads per cell at the sequencing open lab of the German Cancer Research Center.
-
bioRxiv - Genetics 2024Quote: ... including (1) updating SNP alleles (convert from Illumina A/B alleles to the genetic A ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µL of 10 µM Nexterra N7XX (Illumina) primer ...
-
bioRxiv - Genetics 2024Quote: ... and feature barcoding libraries were pooled at a 4:1:1 ratio and treated with Illumina Free Adapter Blocking Reagent (Illumina, #20024144). Sequencing of pooled libraries was carried out on a NextSeq 2000 sequencer (Illumina) ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequencing (Illumina sequencing single-reads, 1 × 50 bp) of the resulting input and IP samples performed by Fasteris (Geneva ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 μl of tagment DNA enzyme 1 (Illumina, 20034197), water ...
-
bioRxiv - Genomics 2021Quote: ... and 1.5 ul reverse primer (Illumina TruSeq Read 1), 4 ul cDNA ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL 12.5 μM Nextera Ad2 barcoded primer (Illumina), 23 μL water) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 μl Tn5 (Tagment DNA Enzyme 1 (TDE1) (Illumina)) and 25 μl Tagment DNA Buffer (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... then sequenced (1×50 nt) with a HiSeq4000 (Illumina).
-
bioRxiv - Plant Biology 2024Quote: ... 1% of spike-in PhiX Control v3 (#15017666, Illumina) was also loaded.
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µL of 10 µM RPI-X primer (Illumina), 1 µL of 10 µM P5-TSO primer ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2024Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
bioRxiv - Immunology 2024Quote: ... using the TruSeq SBS Kit v.3 (Illumina). An average of 75 million paired reads was generated per sample.
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Neuroscience 2024Quote: Biomarker Core Facility at King’s College London for library preparation (single cell 3’ version 3 on a Chromium 10X instrument) and sequencing (Illumina NextSeq system).
-
bioRxiv - Cell Biology 2020Quote: ... the genotyping was analyzed using GenomeStudio 1 genotyping module (Illumina). Thereafter ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... approximately 1 million individuals were pooled and sequenced by Illumina paired-end reads (2*150bp) ...
-
bioRxiv - Genomics 2021Quote: ... legs and ovipositor and sequenced by Illumina (Supp data 1)20–22 ...
-
bioRxiv - Immunology 2022Quote: ... A library input of 1.8 pM with 1% PhiX (Illumina) spike-in was sequenced using the NextSeq 500 instrument with the NextSeq500/550 High Output v2.5 Kit (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 0.5 µl Tagment DNA Enzyme 1 (FC-121-1030, Illumina) was added to the 10µl suspension ...