Labshake search
Citations for Illumina :
201 - 250 of 9017 citations for Retinol Binding Protein High Sensitivity ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... using NextSeq 500/550 High Output Kit v2.5 (150 Cycles, cat.no. 20024907, Illumina, San Diego, CA, USA), paired-end read type and Single-Index ...
-
bioRxiv - Molecular Biology 2021Quote: ... Verified samples were sequenced using the NextSeq 500/550 High Output Kit v2.5 (150 Cycles) (Illumina, 20024907) on a Nextseq 550 system (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries for high throughput DNA sequencing were prepared using the TruSeq®ChIP Sample Preparation kit (Illumina) according to the manufacturer’s protocol starting with 10 ng dsDNA from the previous step ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing was performed on an Illumina NextSeq 550 system with a High-Output Kit (75 cycles) (Illumina). Low heterogeneity was either addressed by using a custom sequencing primer binding immediately upstream of the sgRNA targeting sequence or by using the standard Illumina sequencing primer and adding 20% PhiX.
-
bioRxiv - Cancer Biology 2019Quote: ... High-throughput sequencing libraries were constructed using the TruSeq ChIP Sample preparation kit (Illumina, San Diego, CA) and sequenced on a HiSeq 2500 (Illumina ...
-
bioRxiv - Systems Biology 2020Quote: Libraries were sequenced for 75 cycles with the NextSeq 500/550 High Output Kit v2.5 (20024906, Illumina). Cycles were allocated as follows ...
-
bioRxiv - Genomics 2019Quote: ... using the NextSeq 500/550 High Output v2 150-cycle kits (Illumina, Cat no. FC-404-2002). To minimize technical variation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Samples were sequenced on a NextSeq 500 instrument with NextSeq 500/550 High Output v2.5 kits (Illumina) to obtain 75-bp paired-end reads at an average depth of 15 million reads per sample ...
-
bioRxiv - Systems Biology 2021Quote: ... before sequencing with NextSeq® 500/550 High Output Kit v2 (Illumina, FC-404-2005, 75 cycles).
-
bioRxiv - Developmental Biology 2022Quote: ... High quality cDNAs were further constructed sequencing libraries by using Nextera XT DNA Sample Preparation Kit (Illumina). Each single-cell cDNAs were sequenced 50 pair-end on the Illumina HiSeq 2500.
-
bioRxiv - Neuroscience 2020Quote: Sequencing libraries were prepared from high-quality genomic DNA using the TruSeq DNA PCR-Free kit (Illumina) and ultra-deep whole genome sequencing (average 30X read-depth across the genome ...
-
bioRxiv - Immunology 2020Quote: ... using 2×75bp paired-end reads with a High Output 150 cycle kit (Illumina, FC-404-2002).
-
bioRxiv - Cancer Biology 2021Quote: ... 2014) and sequenced on Illumina NextSeq 500 sequencer using a high-output V2 75 cycle kit (Illumina) in 37 bp paired-end mode ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were sequenced by paired-end sequencing with a 75 cycle high-output Nextseq 500 kit (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were sequenced by paired-end sequencing with a 300 cycle high-output Nextseq 500 kit (Illumina). Data analysis was performed using CapCruncher v0.2.0 (https://doi.org/10.5281/zenodo.6326102 ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were sequenced using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Primary data analysis was performed with the Illumina RTA version 2.4.11 and base calling software version bcl2fastq-2.20.0.422.
-
bioRxiv - Cell Biology 2019Quote: ... Samples were sequenced using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Primary data analysis was performed with the Illumina RTA version 2.4.11 and base calling software version bcl2fastq-2.20.0.422.
-
bioRxiv - Evolutionary Biology 2021Quote: ... A shotgun DNA library was constructed using a TruSeq Nano DNA High Throughput Library Prep Kit (Illumina), and the resulting library was subjected to pair-end sequencing with a Novaseq 6000 sequencer (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... Sequencing libraries were prepared from high-quality genomic DNA using the TruSeq DNA PCR-Free kit (Illumina) and ultra-deep whole genome sequencing (average 30X read-depth across the genome ...
-
bioRxiv - Developmental Biology 2022Quote: ... using the NextSeq® 500/550 High Output Kits v2.5 (50 cycles; Cat# FC-404-2005, Illumina). The sequencing outputs were processed using the CellRanger software v3.1.0 on the Massachusetts Green High Performance Computer Cluster (GHPCC) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 % PhiX was added and then sequenced with NextSeq 500/550 High Output Kit v2.5 (Illumina, #20024907).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were run individually using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina, 20024907) and sequenced on an Illumina NextSeq550.
-
bioRxiv - Microbiology 2023Quote: ... and then libraries were prepared using the TruSeq DNA PCR Free High Throughput Library Prep Kit (Illumina). Paired-end reads of 100 bp were generated with an Illumina platform (library preparation and sequencing were performed by Macrogen Japan).
-
bioRxiv - Genomics 2023Quote: ... The sequencing library was then sequenced using a 75 bp single-read NextSeq High Output kit (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... Verified libraries were sequenced using the Nextseq 500/550 High Output kit v2.5 (75 Cycles) (Illumina, 20024906) on a Nextseq 550 system ...
-
bioRxiv - Cancer Biology 2023Quote: Sequencing was performed with an Illumina NextSeq 500/550 using a 150-cycle High Output Kit (Illumina) with an 8-base index read ...
-
bioRxiv - Genomics 2023Quote: ... and scATAC-seq libraries were sequenced on Illumina NextSeq instruments using NextSeq High Output Kit (Illumina #20024907) with 64 cycles for read 1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... prior to sequencing on an Illumina NextSeq 500 using the 75-cycle High Output v2 kit (Illumina). In total ...
-
bioRxiv - Molecular Biology 2023Quote: ... 75-bp sequencing was performed using an Illumina NextSeq 500/550 High Output v2.5 kit (Illumina 20024906) on a NextSeq 500 System.
-
bioRxiv - Developmental Biology 2023Quote: ... Sequencing was performed on a Nextseq500/550 High Output Kit v2.5 75 cycles (Illumina; paired-end sequencing), and each sample was sequenced for 6M reads ...
-
bioRxiv - Neuroscience 2023Quote: ... and the small RNA fraction sequenced (NextSeq 500/550 High Output Kit v2.5 75 Cycles, 20024906, Illumina). For poly(A)-selected RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced 2x36 with an NextSeq 500/550 High Output v2.5 75 cycles kit (Illumina, 20024906) on a NextSeq 550 ...
-
bioRxiv - Cancer Biology 2024Quote: Libraries for whole-genome sequencing (WGS) were prepared using the TruSeq DNA Nano High Throughput kit (Illumina) and sequenced as 150bp paired-end reads on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were run individually using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina, 20024907) and sequenced on an Illumina NextSeq550 instrument.
-
bioRxiv - Cell Biology 2019Quote: ... Paired end sequencing was performed on the Illumina NextSeq 500 using the High Output 150 cycle Kit (Illumina).
-
bioRxiv - Genetics 2021Quote: ... 1 µg of high quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Next Generation Sequencing was performed on a NextSeq500 platform using a NextSeqTM500 150-cycle High Output Kit) (Illumina) to generate 80-basepair paired end reads.
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-sequencing was performed using NextSeq75 High Output v2 kit and NextSeq 500 (Illumina; cat# FC-404-2005). Using TruSeq 3’ SE adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Cell Biology 2022Quote: ... with High output Kit v2.5 (150 cycles) for paired-end sequencing according to standard procedure provided by Illumina.
-
bioRxiv - Immunology 2022Quote: ... spike-in was sequenced using the NextSeq 500 instrument with the NextSeq500/550 High Output v2.5 Kit (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation of high-quality RNA (RIN >8) was performed using the TruSeq RNA sample preparation kit (Illumina). Raw sequencing data was aligned to human genome B38 ...
-
bioRxiv - Genomics 2021Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Immunology 2021Quote: ... All SMART-Seq2 Libraries were sequenced using a NextSeq 500/550 High Output v2 kit 75 cycles (Illumina) on a Nextseq 500 (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... Single-end sequencing was performed with a NextSeq 500 with a High Output Mode 75 Cycles Kit (Illumina). Expression levels were computed as transcripts per million (TPM ...
-
bioRxiv - Immunology 2022Quote: ... diluted to 1.8pg/ml and loaded onto a NextSeq 500/550 High Output Kit v2.5 (150 cycles, Illumina) and paired-end sequencing was performed on a NextSeq 550 (Illumina).
-
bioRxiv - Immunology 2022Quote: ... High-resolution 4-digit HLA typing was performed with the TruSight HLA v2 Sequencing Panel kit from Illumina according to the manufacturer instruction ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing was performed using NextSeq 500/550 High-Output v2.5 (150 cycle) kit on NextSeq 550 platform (Illumina). Libraries were combined into a single equimolar pool of 12 ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA sequencing was performed on an Illumina NextSeq500 platform (SBS50 kit, high-output mode, Illumina, San Diego, CA) using default parameters for paired-end sequencing (76bp + 9bp) ...
-
bioRxiv - Systems Biology 2023Quote: ... next-generation sequencing (NGS) was performed using NextSeq 500/550 high output v2 kit (150 cycles) (Illumina, USA) to obtain 800 x 106 paired reads per pool (50 x 106 paired reads per sample) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a custom sequencing primer (MAC-seq Read primer) and a High Output Kit v2.5 75 Cycles (Illumina) with paired-end configuration (25 base pairs for read 1 and 50 base pairs for read 2).