Labshake search
Citations for Illumina :
1 - 50 of 9017 citations for Retinol Binding Protein High Sensitivity ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... CUT&Tag assay was performed using NovoNGS CUT&Tag 3.0 High-Sensitivity Kit (for Illumina, Novoprotein scientific Inc. ...
-
bioRxiv - Cell Biology 2020Quote: QC and quantification of libraries were done by Bioanalyzer (High-Sensitivity DNA Bioanalyzer kit) and mi-seq (Illumina). Sequencing was carried out at the New York Genome Center (NYGC ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were quantified sing Qubit High-Sensitivity DNA kit and preparation kit and libraries were constructed using Nextera XT DNA tagmentation (Illumina FC-131-1096) using 800 pg of pooled cDNA library as input using index primers with format as in Gierahn et al [46] ...
-
bioRxiv - Genomics 2021Quote: ... The integrity of the DNA was assessed by capillary electrophoresis using the High Sensitivity Genomic DNA Analysis kit on the Fragment Analyzer (Illumina). Short insert (300 bp ...
-
bioRxiv - Microbiology 2020Quote: ... The quality of the DNA sample was checked by running the Agilent High Sensitivity DNA Kit using an Agilent 2100 Bioanalyzer before sequencing using HiSeq 2500 (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... High Sensitivity D1000 tape and then sequenced on a NextSeq 500 sequencer (Illumina) using a 75-cycle High Output kit using a custom read1 primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Final libraries were quantified on a high-sensitivity bioanalyzer chip and sequenced on the HiSeq (Illumina). Bulk RNA-Seq files are pre-processed for quality control using fastp with default parameters ...
-
bioRxiv - Cancer Biology 2022Quote: ... ScRNA-seq libraries were prepared using the Next GEM Chromium single cell 3′ reagent kits V3.1 with feature barcode technology for cell surface protein (10x genomics) and sequenced using NextSeq 500 high output kits and Novaseq S4 PE100 kits (Illumina). scRNA-Seq data after standard quality control was aligned to the reference genome (mm10 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Final libraries were quantified on a high-sensitivity bioanalyzer chip and sequenced on the NextSeq 550 (Illumina).
-
bioRxiv - Genomics 2019Quote: ... used GATK HaplotypeCaller50 (version 3.5, code at https://hub.docker.com/r/broadinstitute/gatk3) with high-sensitivity settings from Illumina HiSeq 300x 2×150 bp data for the AJ trio ...
-
bioRxiv - Genomics 2019Quote: ... generated independently for each individual in the trio, used freebayes51 (version 0.9.20, code at https://github.com/ekg/freebayes) with high-sensitivity settings from Illumina HiSeq 300x 2×150bp data for the AJ trio ...
-
bioRxiv - Genomics 2019Quote: ... used the Spiral Genetics Anchored Assembly variant caller (version May 2015, from https://www.spiralgenetics.com/) with high-sensitivity settings from Illumina HiSeq 50x (downsampled by run ...
-
bioRxiv - Cancer Biology 2021Quote: ... with the High Output Kit (Illumina), and a minimum of 35 million read-pairs was generated for each sample.
-
bioRxiv - Cell Biology 2023Quote: ... with High Output NextSeq kit (Illumina) using 2x 75bp paired-end reads.
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were quality controlled with Agilent Bioanalyzer High Sensitivity dsDNA chips and sequenced on a NovaSeq 6000 System (Illumina) at a sequencing depth of a minimum of 60,000 reads per Visium spot ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was quantified using the High Sensitivity DNA Assay on the Agilent 2100 Bioanalyser and paired end Nextera XT (Illumina) libraries were made and sequenced ...
-
bioRxiv - Genomics 2022Quote: ... The fragment size of every library was analysed using the Bioanalyzer high-sensitivity chip and were sequenced on NextSeq500 instruments (Illumina) with the following sequencing parameters ...
-
bioRxiv - Microbiology 2019Quote: ... with NextSeq75 High Output v2 kit (Illumina) and paired end 2x 38 bp reads were generated ...
-
bioRxiv - Plant Biology 2019Quote: ... using a MiniSeq High Output kit (Illumina). Total sequencing yielded 12.4 Gbp and generated between 0.73 Gbp and 1.49 Gbp per sample ...
-
bioRxiv - Genomics 2021Quote: ... with a NextSeq High Output kit (Illumina) platform with 2 x 150 read length.
-
bioRxiv - Developmental Biology 2021Quote: ... using NextSeq500/550 High Output v2.5 Kit (Illumina) to obtain single-end 75 nt reads ...
-
bioRxiv - Cell Biology 2019Quote: ... using NextSeq High Output Kit v2.5 reagents (Illumina). Raw data is in process of being deposited into Gene Expression Omnibus (GEO accession #TBD).
-
bioRxiv - Cell Biology 2020Quote: ... using NextSeq High Output Kit v2 reagents (Illumina). Raw and processed data are publicly available in the Gene Expression Omnibus (GSE144933 ...
-
bioRxiv - Cell Biology 2020Quote: ... using NextSeq High Output Kit v2.5 reagents (Illumina). Libraries for RNA-seq experiments shown in Fig ...
-
bioRxiv - Developmental Biology 2019Quote: ... using the 150 cycles high output kit (Illumina).
-
bioRxiv - Neuroscience 2019Quote: ... using NextSeq High Output Kit v2 reagents (Illumina).
-
Disruption of the TCA cycle reveals an ATF4-dependent integration of redox and amino acid metabolismbioRxiv - Biochemistry 2021Quote: ... the NextSeq 75 cycle high output kit (Illumina) was used and samples spiked in with 1% PhiX ...
-
bioRxiv - Systems Biology 2022Quote: ... using NextSeq High Output Kit v2 reagents (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... using the High-Output v2.5 Kit (20024906, Illumina) with 75 bp single-end reads.
-
bioRxiv - Plant Biology 2023Quote: ... and NextSeq 500/550 High Output Kit (Illumina). Reads were mapped as described and differential gene expression analysis was performed with edgeR (Robinson et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the NextSeq500/550 High Output v2.5 Kit (Illumina). The sequence reads were aligned against GRCh38 genome assembly using the cellranger count command of Cell Ranger (version 4.0.0 ...
-
bioRxiv - Microbiology 2019Quote: ... with NextSeq75 High Output v2.5 kit (Illumina cat# 20024906) to generate paired-end 2×42 bp reads ...
-
bioRxiv - Cell Biology 2021Quote: ... with Miniseq High output reagent kit (150-cycles) (Illumina). Calculation of Occupancy Ratio (OR ...
-
bioRxiv - Cancer Biology 2019Quote: ... using Nextseq 500/550 High Output v2 Kit (Illumina) to obtain single end 75-nt reads ...
-
bioRxiv - Immunology 2022Quote: ... using the NextSeq 500/550 High Output Kit (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... with a NextSeq 500 High-Output Kit v2 (Illumina) (52 cycles).
-
bioRxiv - Microbiology 2023Quote: ... using the MiniSeq High-Output Kit (150 cycles, Illumina) generating 20 million 151 bp single-end reads.
-
bioRxiv - Immunology 2023Quote: ... using NextSeq 500 High Output reagent kit (Illumina Inc) (1×75 cycles ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a NextSeq high output 75 cycle kit (Illumina). Reads were trimmed for Nextera and Illumina adapter sequences using trimgalore(64 ...
-
bioRxiv - Genetics 2023Quote: ... or the 75 cycle High Output Kit (Illumina # 20024906), 37 cycles per read.
-
bioRxiv - Genomics 2023Quote: ... and sequenced using a high output reagent kit (Illumina) at the Institute for Molecular Bioscience Sequencing Facility ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Nextseq 500/550 High Output v2.5 Kit (Illumina) to obtain single end 75 nt reads.
-
bioRxiv - Cell Biology 2023Quote: ... using the High Output Kit v2.5 (Illumina, cat.no. 20024906) with 75 cycles of single-end sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... using the NextSeq 300-cycle high output kit (Illumina) to generate 2 × 151 bp paired-end reads.
-
bioRxiv - Bioengineering 2021Quote: ... using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kit (Illumina). Sequencing was performed at the Genomics Research Unit ...
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed using random hexamer primers that introduce Truseq Small RNA kit RP1 primer binding sites (Illumina) and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index ...
-
bioRxiv - Genomics 2020Quote: ... using the NextSeq High Output Kit (150 cycles; 20024907, Illumina) with the following read protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... using the V2 High output kit (Illumina, #TG-160-2005) in accordance with the Illumina Protocol 15046563 v02 ...
-
bioRxiv - Cancer Biology 2021Quote: ... using NextSeq 500/550 High Output kit v2.5 (Illumina, 20024906) with 28 cycles for read 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... using the NextSeq 500 High Output v2 Kit (Illumina, US). The library sequencing saturation was on average 68.73% ...