Labshake search
Citations for Illumina :
201 - 250 of 2336 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Miniaturization involved testing libraries at 1/6th (IDT mini) or 1/8th (Roche mini, Illumina mini) of reaction volume tailoring input DNA to each kit between 24-45 ng total (Table 2) ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μtagment DNA enzyme (Nextera, Illumina), l nuclease free water ...
-
bioRxiv - Genetics 2019Quote: ... supplemented with 1 μl Tn5 (Illumina). Samples were then reverse cross-linked using the iDeal® ChIP-seq kit for histones according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 1 μl of transposase (Nextera, Illumina) was added and samples were incubated at 37°C for 10 minutes followed by two washes with low-salt buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The quantified and denatured libraries were sequenced using paired-end 2×250-bp chemistry with 5% PhiX as an internal control on the Illumina MiSeq 2000 platform (Illumina Inc., USA). The quality-filtered reads were de-novo assembled using SPAdes (version 3.11.1) ...
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Immunology 2020Quote: ... cells were lysed in lysis buffer for 1 minute and transposed with Tagment DNA Enzyme 1 (Illumina) for 30 minutes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The library was pooled with other samples at equimolar concentrations and sequenced at 4 nM as single lanes on Illumina NovaSeq 6000 S4 platform (2×150; Illumina Inc., San Diego, CA). The library for long-read data was prepared using the Nanopore ligation kit ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Genetics 2020Quote: ... using a bead-to-DNA ratio of 1:1 before high-throughput sequencing on the MiniSeq system (Illumina). Libraries were sequenced 1 × 75bp for a minimum coverage of 2 million read depth ...
-
bioRxiv - Genomics 2022Quote: ... Consensus LADs (between the Nanopore-DamID undiluted and 1:1/10 dilution and between the two Illumina replicates) were determined using intersectBed.
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Genomics 2021Quote: ... 0.4 µM oligo 1 (a truncated Illumina read 1 sequence followed by six random bases ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Read 1 sequence (excluding Illumina barcodes) was aligned to a short reference sequence of AAV9:
-
bioRxiv - Synthetic Biology 2022Quote: ... The Read 1 sequence (excluding Illumina barcodes) was aligned to a short reference sequence of AAV9 ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Microbiology 2019Quote: ... mixed with the PhiX control library v3 (diluted to 7 pM; Illumina, San Diego, USA), and loaded on an Illumina MiSeq cartridge ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Genomics 2021Quote: ... and four mate-pair sequencing libraries (insert sizes of 2, 5, 10, and 15 kb) in accordance with manufacturer protocols (Illumina, San Diego, CA, USA). Libraries were then sequenced using a HiSeq2000 instrument (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... and diluted to 5 pM prior to sequencing on an Illumina MiSeq platform with a 2 × 250 bp paired-end protocol (Illumina, San Diego, CA, USA). Sequencing reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Genomics 2021Quote: ... at a 1:1 ratio and constructed into sequencing libraries using TruSeq DNA Preparation Kit (Illumina Inc, California, US). Sequencing was carried out using Illumina MiSeq paired-end 2 × 300 bp and performed by the High-Throughput Sequencing Core Facility in Biodiversity Research Center in Academia Sinica.
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Developmental Biology 2020Quote: ... assays for size distribution and concentration prior to pooling the multiplexed libraries for single-end 1×51nt or 1×75 sequencing on the HiSeq 2500 or HiSeq 4000 System (Illumina). Libraries were sequenced to a depth of >20M uniquely aligned reads.
-
bioRxiv - Plant Biology 2020Quote: ... A total of 56 samples (Appendix 1) were sequenced together on one lane of 1×75bp NextSeq500 High Output (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... using single end 63bp for Read 1 and 12bp for index 1 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sequence data were first converted into fastq format using bcl2fastq v2.17.1.14 with the following parameters --use-bases-mask=Y150,I13,I12,Y150 --minimum-trimmed-read-length=1 --mask-short-adapter-reads=1 --create-fastq-for-index-reads (Illumina).
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were run on an Illumina Nextseq 550 instrument using the MetSeq Primer 1 (NuGEN) mixed with the Read 1 primer (Illumina) according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2019Quote: ... and 1 µl of Nextera Tn5 enzyme (Illumina) on ice and incubated at 55°C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 12 assemblies were done: 1) baseline (Illumina only), 2 ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL 12.5 μM Nextera Ad1 primer (Illumina), 1 μL 12.5 μM Nextera Ad2 barcoded primer (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 µL of amplicon tagmentation mix (Illumina) in a final volume of 10 µL and incubated at 55 °C for 7 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Read 1 was read with primer HP6 (Illumina) with 3 dark cycles (first 3 bases of read 1 were not read) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries with 1 % spiked-in PhiX control (Illumina) were sequenced at the 75-bp paired end on a high output flow cell using an Illumina NextSeq550 instrument at a sequencing depth of ∼1 M reads per cell at the sequencing open lab of the German Cancer Research Center.
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...