Labshake search
Citations for Illumina :
1 - 50 of 2336 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... puteoserpentis (499ROV/1-4) specimens using short-read (Illumina HiSeq 3000) and long-read (PacBio ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Genomics 2021Quote: ... Lab 1 and 2 sequenced DNA with a NovaSeq 6000 (Illumina,
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2023Quote: ... coverage and eight additional female genomes (4 Asian and 4 African) at ~30× (1 lane of Illumina Hiseq X Ten) coverage using 10x Linked-Reads at HudsonAlpha Institute of Biotechnology ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Microbiology 2021Quote: ... The library was diluted to a final concentration of 7 pM and 5% of PhiX DNA (Illumina, USA) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... with MiSeq Reagent Kit V3 (150 cycle) (Illumina, MS-1-2-3001). The sequencing data was de-multiplexed and trimmed to contain only the sgRNA sequence cassettes ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the NEBNext Ultra II DNA Library Preparation kit was used to generate libraries using 5-10 ng of input or immunoprecipitated DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina (Set 1, E7335 and Set 2, E7500)) ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Each batch was sequenced separately on 1-flowcell (2 lanes) HiSeq 2500 (Illumina) Rapid Mode platform with a single-end (1×50 bp ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1 ...