Labshake search
Citations for Illumina :
151 - 200 of 9027 citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Genomics 2022Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... equimolar amounts of the libraries underwent a c-Bot (Illumina) bridge PCR followed by single end sequencing for 77 cycles on an Illumina Hiseq2500 ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was amplified using PE primers (Illumina) with 10 PCR amplification cycles ...
-
bioRxiv - Genomics 2023Quote: ... Illumina Nextera DNA Unique Dual Indexes Set C (Illumina, 20027215) were added and amplified (12 cycles ...
-
bioRxiv - Genetics 2020Quote: ... Plates were multiplexed and sequenced on the MiSeq platform (Illumina) using 250 bp paired-end reads (Nano kit ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification was performed in a 48 well plate (Illumina) on an Eco machine (Illumina) ...
-
bioRxiv - Genomics 2022Quote: ... Full-length adapters (IDT TruSeQ UDI plate, Illumina, cat# 20023784) were used for adapter ligation ...
-
bioRxiv - Systems Biology 2020Quote: ... Supernatants were discarded and nuclei were re-suspended in 50 μl reaction buffer (2.5 μl of Tn5 transposase and 25 μl of TD buffer from a Nextera DNA Library Prep Kit from Illumina, and 22.5 μl nuclease-free H2O). The reaction was incubated at 37°C for 30 min ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Genomics 2019Quote: ... Hi-C libraries were prepared for sequencing on HiSeq 4000 (Illumina). After sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... after which the plates were sequenced on the NextSeq 500 (Illumina) for 25 million reads per plate.
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Genomics 2019Quote: ... and the Hi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... The pool was adjusted to 10pM for clustering on C-Bot (Illumina) and then sequenced Paired-End 101 bases using the HiSeq SBS Kit v4 (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Immunology 2023Quote: ... Four plates were pooled together and sequenced on a NextSeq500 instrument (Illumina) with 75 bp paired-end reads in high-output mode.
-
bioRxiv - Genomics 2024Quote: ... with IDT for Illumina UD Indexes (96x, Plate A, Set 1, Illumina). Library size selection was performed to remove fragments below 180 bp and above 700 bp using AMPure XP beads (Beckman coulter) ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Genomics 2019Quote: ... and the Promoter CHi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Genomics 2021Quote: We downloaded publicly-available Hi-C data from human prefrontal cortex tissue23,24 (Illumina HiSeq 2000 paired-end raw sequence reads ...
-
bioRxiv - Genomics 2020Quote: ... Hi-C libraries were paired-end sequenced on a NovaSeq 6000 system (Illumina). Raw data were processed with the ENCODE 4 pipeline for Hi-C according to ENCODE 4 standards (https://www.encodeproject.org/documents/75926e4b-77aa-4959-8ca7-87efcba39d79/).
-
Dual symbiosis in the deep-sea hydrothermal vent snail Gigantopelta aegis revealed by its hologenomebioRxiv - Genomics 2020Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp ...
-
bioRxiv - Cancer Biology 2022Quote: ... Hi-C libraries were sequenced 2×150bp on a NovaSeq 6000 instrument (Illumina). Juicer were used to process raw reads and generate Hi-C contact matrices (.hic files) ...
-
bioRxiv - Genetics 2022Quote: ... the products from each sample were bulked and applied to c-Bot (Illumina) bridge PCR followed by sequencing on Illumina Hiseq2500 ...
-
bioRxiv - Genomics 2023Quote: ... The Hi-C library was sequenced on a NovaSeq 6000 platform (Illumina, USA) and generated reads with a length of 150 bp producing 32.08 Gbp of data in total (Supplementary Table 1) ...
-
bioRxiv - Plant Biology 2023Quote: ... Hi-C libraries were sequenced on Illumina NextSeq500 (Illumina, San Diego, CA, USA) platform using platform using High Output Kit v2.5 (150 Cycles).
-
bioRxiv - Molecular Biology 2022Quote: ... 5% v/v TDE1 Tagment DNA Enzyme (Illumina, Cambridge, UK) in nuclease free water (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 μl of NT buffer (Illumina, FC-121-1030) was added to each tube to neutralize the tagmentation reaction ...
-
bioRxiv - Genomics 2021Quote: ... 5-10% spike-in library (e.g. PhiX control from Illumina) must be added to the lane to balance the nucleotide distribution at the beginning of the forward and reversed reads ...
-
bioRxiv - Genetics 2023Quote: ... 5 μl Nextera XT V2 Index (Illumina, FC-131-2001) primer N7xx ...
-
bioRxiv - Systems Biology 2020Quote: ... Ten C1 plates were combined for analysis using the NovaSeq 6000 System (Illumina). We used SingleR to cluster by cell types per subject and we analyzed enrichment of KEGG pathways per cell type.