Labshake search
Citations for Illumina :
51 - 100 of 9027 citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5 ng of DNA was used as input to create Illumina sequencing libraries using the Nextera kit (Illumina). The samples were pooled and sequenced on an Illumina NextSeq 500 High Output system to obtain 2×150 bp reads ...
-
bioRxiv - Plant Biology 2020Quote: ... custom adapters for selecting 5’-P mRNAs and primers from the TruSeq Small RNA Sample Preparation Kit (Illumina) for multiplexing the libraries as indicated in Zhai et al (2014) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Tagment DNA Enzyme and 20 μl nuclease free water (Nextera DNA Sample Preparation Kit, Illumina, UK) for 45 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with four MiSeq reagent kits v2 500 cycles (Illumina). A blank extraction kit control ...
-
bioRxiv - Cancer Biology 2019Quote: ... the Midi plate from Illumina’s Rapid Capture Exome kit was replaced with a skirted PCR plate to facilitate automation ...
-
bioRxiv - Cancer Biology 2019Quote: ... the Midi plate from Illumina’s Nextera Exome Kit was replaced with a skirted PCR plate to facilitate automation ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were pelleted (500xg, 10 min, 4 °C) and tagmented with the Nextera DNA Library Prep Kit (Illumina, FC-121-1030) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell pellet was then mixed and incubated at 37°C for 1h min with the transposition reaction mix prepared using Illumina Tagment DNA Enzyme and Buffer kits (Illumina, 20034197). DNA was then purified using DNA Clean and Concentrator kit (Zymo ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Ribosomal RNA (rRNA) was depleted from 5 ug of total RNA using the Ribo-ZeroTM Gold Kit (Illumina, Inc). Depleted mRNA was fragmented and converted to first-strand cDNA using Superscript III reverse transcriptase (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Genomics 2020Quote: ... and Hi-C sequencing (Illumina sequencing). The tissue samples were stored in liquid nitrogen before sequencing ...
-
bioRxiv - Genomics 2021Quote: ... platform = c(”Illumina Human Methylation 450”), and sample.type = c(”Primary solid Tumor”,”Solid Tissue Normal”) ...
-
bioRxiv - Genomics 2019Quote: Raw Nanopore and Hi-C (Illumina) reads have been deposited in the NCBI SRA and are under the BioProject (PRJNA565796) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... as well as Hi-C (Illumina) chromatin interaction data ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 ul H2O) at 37◻°C for 30◻min (TruePrep® DNA Library Prep Kit V2 for Illumina, Vazyme, China). After the tagmentation ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 ng of cDNA from each cell on the plate was individually tagmented using the Nextera XT kit (Illumina, San Diego, CA) in a final volume of 5 µl ...
-
bioRxiv - Microbiology 2021Quote: PCR free shotgun libraries were prepared for each sample from 2.5 ug metagenomic DNAs by Exeter Sequencing Service for the metagenomic sequencing using the TruSeq DNA library Prep Kit (Illumina). The libraries were sequenced to approximately 7GBp using the HiSeq 2500 rapid run mode (2X 250 bp paired end ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq and DNase-seq libraries were prepared from 1-5 ng ChIP DNA or DNase DNA samples using NEBNext Ultra II DNA library Prep Kit (Illumina). Libraries were sequenced on an Illumina NextSeq 500 with single-end or paired-end 75 bp reads.
-
bioRxiv - Immunology 2019Quote: ... and a mixture of 8 VH family and IgM-specific primers (listed below) containing 5’ adaptors to allow barcoding by the Illlumina TruSeq multiplex pcr kit (Illumina). Resulting PCR products were subjected to 10 cycles of PCR using Illumina TruSeq indexing primers ...
-
bioRxiv - Genomics 2019Quote: ... and three mate-pair libraries (insert sizes of 2 kb, 5 kb, and 8 kb) were constructed using the TruSeq PCR-free Kit (Illumina) and Mate-pair Kit (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... 50 ng of each amplicon was dual indexed in a 5-cycle PCR reaction using the PCR module and indexed primers from the Nextera kit (Illumina). Resulting libraries were purified on AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Immunology 2020Quote: ... Use of 250 pg of cDNA with 1/5 reaction of Illumina Nextera XT kit (Illumina, San Diego, CA, USA). The length distribution of the cDNA libraries was monitored using DNA High Sensitivity Reagent Kit on the Perkin Elmer Labchip GX system (PerkinElmer ...
-
bioRxiv - Genomics 2019Quote: ... 5 mM MgCl2) containing 1 μl Tn5 transposase from the Nextera DNA Library Prep Kit (15028212, Illumina, San Diego, USA) and incubated at 37°C for 10min ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ~2 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina) as previously described [79] ...
-
bioRxiv - Developmental Biology 2020Quote: ... and two different mate-pair libraries (3 kb and 5 kb) were prepared with a Nextera Mate Pair Library Prep Kit (Illumina). Sequencing libraries were run on the Illumina Hiseq 2500 sequencer with a read length of 150 bp ...
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...
-
bioRxiv - Physiology 2021Quote: ... Single-indexed strand-specific cDNA library from total RNA samples (500 ng input with RIN ≥ 5) was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina) as per directions by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... The rRNA-depleted samples were used for TruSeq Stranded RNA Sample Prep kit to produce 5′ to 3′ strand-specific cDNA libraries (Illumina). A TruSeq SBS sequencing kit version 3 (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... Ribosomal RNA (rRNA) was then depleted from each sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Genetics 2019Quote: ... total RNA from cochleae was reverse transcribed with random primers after ribo-depletion using a TruSeq library kit (15031048 Rev. C, Illumina, San Diego, CA), and 2×93bp sequenced on an Illumina HiSeq1500 instrument ...