Labshake search
Citations for Illumina :
151 - 200 of 2306 citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... supplemented with 5% v/v TDE1 Tagment DNA Enzyme (Illumina, Cambridge, UK) in nuclease free water (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 7) DC3000 − A (Illumina only), 8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Cell Biology 2021Quote: ... using NextSeq 500 (2×75 bp) and HiSeq 4000 (1×50 bp) equipment (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing was performed on a HiSeq 2000 series for 2 × 100 paired end reads with a 7 nucleotide read for indexes using Cycle Sequencing v3 reagents (Illumina). All regions were covered by >200 reads.
-
bioRxiv - Genomics 2023Quote: ... The transposition reaction was incubated for 30 min or 1h at 37◦C (Illumina Tagment DNA Enzyme and Buffer kit ...
-
bioRxiv - Microbiology 2020Quote: ... One paired end sequencing run (2 x 301) was completed on an Illumina MiSeq instrument (Illumina, San Diego, CA) using v3 chemistry ...
-
bioRxiv - Immunology 2020Quote: ... The 5’gene expression libraries were sequenced in NextSeq or NovaSeq6000 sequencer (Illumina) using NextSeq 500/550 v2.5 sequencing reagent kit (read length ...
-
bioRxiv - Genomics 2019Quote: ... Each well was then mixed with 5 μL Nextera™ TD buffer (Illumina) and 1 μL i7 only TDE1 enzyme (25 nM ...
-
bioRxiv - Immunology 2019Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... 5 µl nuclease and 2.5 µl Tn5 transposase enzyme (TDE1, Illumina, catalog # 15027865) and incubated for 28 minutes at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... the 5’ Illumina adapter (as used in the Illumina TruSeq Small RNA kit) and a split 2x 3 nt Unique Molecular Identifier (UMI ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli transposition assays were mixed with 5 µL of tagmentation DNA buffer (Illumina) and 1 µL of amplicon tagmentation mix (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... with a loading sample concentration of 10pM and a 5% PhiX (Illumina, U.S.) spike-in ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1–2 mg of total RNA was used for Ribo-Zero rRNA Removal kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments were then amplified by PCR using Nextera index primer 1 and 2 (Illumina) and produced by PCR amplification (10–13 cycles ...
-
bioRxiv - Plant Biology 2021Quote: ... Eighteen libraries differentially indexed using the FastGene Adaptor kit (Nippon Genetics) were multiplexed in one lane and sequenced (2 × 150-bp paired-end reads) on a HiSeq X (Illumina) by GENEWIZ.
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries from 7 independent SCL-exo experiments were sequenced on 7 lanes of a HiSeq 1500 (Illumina) by the GEH facility (Rennes ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µg of total cellular RNA was depleted of ribosomal RNA (RiboZero kit, Illumina), and subjected to base hydrolysis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries generated with indexing version 2 (Supplementary Table 1) were sequenced on a HiSeq4000 (RRID:SCR_016386, Illumina) using custom sequencing primers with following read lengths ...
-
bioRxiv - Genetics 2019Quote: ... An average of 39.7 million 2 x 75 bp paired- end reads were generated for each sample on an Illumina NextSeq 500 (Illumina, Carlsbad, CA). FastQC was used to evaluate the quality of the reads ...
-
bioRxiv - Genomics 2023Quote: ... indexed using IDT for Illumina Nextera UD indexes Sets 1–4 (384 Indexes, Cat no: 20043137, Illumina, USA) and products were amplified ...
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Microbiology 2022Quote: ... diluted at a ratio of 1:2 and amplified following the Nextera XT Index protocol (Illumina, Inc.). The amplicons were normalized using a SequalPrep™ Normalization Plate Kit (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Genomics 2020Quote: one individual was resequenced by Illumina NovaSeq6000 S4 at Psomagen Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μg DNase-treated RNA was used as input for ribosomal depletion using the Epicentre (Illumina) Ribo-Zero ribosomal depletion kit (Cat# SCL24H) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mRNA 5′ end libraries were multiplexed again and then sequenced on HiSeq 4000 (Illumina) using paired-end (2x 100 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... Completed libraries were pooled in an equimolar ratio along with 5% PhilX Control Library V3 (Illumina), denatured and diluted to 2.0pM as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... parental fish were whole-genome sequenced with 5–10X coverage (Illumina Hiseq platforms, BGI Hong Kong). The genotyping of F1 fish was carried out with the DarTseq technology (Diversity Arrays Technology ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...