Labshake search
Citations for Illumina :
51 - 100 of 2306 citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
bioRxiv - Bioengineering 2019Quote: ... incubated and room temperature for 5 minutes and diluted again to a final concentration of 4 pM using HT1 Buffer (Illumina, USA) and loaded into the MiSeq Reagent Nano Kit v2 cartridge (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicon library pool was diluted to 2 nM with sodium hydroxide and 5 mL were transferred into 995mL HT1 (Illumina) to give a final concentration of 10 pM ...
-
bioRxiv - Genomics 2019Quote: ... and three mate-pair libraries (insert sizes of 2 kb, 5 kb, and 8 kb) were constructed using the TruSeq PCR-free Kit (Illumina) and Mate-pair Kit (Illumina) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ~2 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina) as previously described [79] ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... puteoserpentis (499ROV/1-4) specimens using short-read (Illumina HiSeq 3000) and long-read (PacBio ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...