Labshake search
Citations for Illumina :
151 - 200 of 1827 citations for 4 5 5 5 Tetrafluoro 4 trifluoromethoxy pentan 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Genetics 2021Quote: ... We find that even sequencing error rates as high as 5% (50x higher than Illumina sequencer error) have very little effect on clustering quality under most correlation cut-offs ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were sequenced (5’ single end; single-end 75x) using the NextSeq500 high-throughput sequencing system (Illumina) at the Cornell University Biotechnology Resource Center ...
-
bioRxiv - Cell Biology 2021Quote: ... The purified DNA was PCR amplified for 5 cycles using a Nextera DNA Library Index kit (Illumina) and Phusion HF Master Mix (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... was performed with ~5 million reads / sample in single-end mode on the NextSeq 500 platform (Illumina), using the High Output Kit v2.5 (75 cycles) ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in ATAC lysis buffer for 5 min and then transposed with TN5 transposase (Illumina) for 30 min ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Biochemistry 2020Quote: 5 µg total RNA isolated from Flag elution samples were treated with Yeast RiboZero Gold (Illumina, MRZY1306) according to the manufacturer’s instructions to remove yeast rRNAs from the samples ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 5’GEX libraries were sequenced each of on a separate lane of HiSeq4000 flow cell (Illumina) to target sequencing depth of 50,000 read pairs per sample ...
-
bioRxiv - Immunology 2022Quote: ... cells were lysed in ATAC lysis buffer for 5 minutes and then transposed with TN5 transposase (Illumina) for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Plant Biology 2022Quote: ... and 5 mM β-mercaptoethanol) and then subjected the nuclei to a transposition reaction with Tn5 (Illumina). The transposition reaction was performed with 25 μl of 2x DMF (66 mM Tris-acetate pH 7.8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples that qualified (RIN>5) were prepped using the standard protocol for Illumina Stranded mRNA prep (Illumina). Sequencing was done using the Illumina NextSeq 2000 with paired-end 59 bp × 59 bp reads ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 million 75-nt single reads per sample were determined using a NextSeq High Output (Illumina), with >96% of the reads having a Q30 quality.
-
bioRxiv - Microbiology 2024Quote: ... 5 μg of the total RNA was processed by Ribo-Zero rRNA Removal Kit (Bacteria) (Illumina, MRZMB126). Sequencing libraries for RNA-Seq were constructed using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... Tagementation reaction was stopped by quenching the reaction with 1.25ul of NT buffer for 5 mins (Illumina). 1.25 ul of the i5 and i7 Illumina indexes were added to the plates ...
-
bioRxiv - Systems Biology 2021Quote: ... Libraries were then pooled in groups of 4 and sequenced on 4 lanes on a NextSeq500 sequencer (Illumina) using 10X Genomics recommended reads configuration.
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was tagmented in 5 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and 5’-end RNA-seq library preparation using tagmentation-based modified Nextera XT DNA sample Preparation kit (Illumina). Libraries were tagged with a plate-specific i7 index and were pooled for sequencing on an Illumina NextSeq2000 platform ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5’-end RNA-seq library preparation using tagmentation-based modified Nextera XT DNA sample Preparation kit (Illumina). Libraries were tagged with a plate-specific i7 index and were pooled by batches of 4-9 plates for sequencing on an Illumina NextSeq550 platform ...
-
bioRxiv - Microbiology 2021Quote: ... 5 ng of DNA was used as input to create Illumina sequencing libraries using the Nextera kit (Illumina). The samples were pooled and sequenced on an Illumina NextSeq 500 High Output system to obtain 2×150 bp reads ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then lysed and fragmented in a single reaction (12.5 µl 2X Illumina TDE buffer, 2.5 µl 1% Tween-20, 2.5 µl 0.2% Digitonin, 5 µl water, 2.5 µl Illumina TDE1 enzyme). Samples were incubated at 37°C for 60 minutes and purified using the Zymo DNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Plant Biology 2020Quote: ... custom adapters for selecting 5’-P mRNAs and primers from the TruSeq Small RNA Sample Preparation Kit (Illumina) for multiplexing the libraries as indicated in Zhai et al (2014) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Tagment DNA Enzyme and 20 μl nuclease free water (Nextera DNA Sample Preparation Kit, Illumina, UK) for 45 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The library was diluted to a final concentration of 7 pM and 5% of PhiX DNA (Illumina, USA) was added ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with four MiSeq reagent kits v2 500 cycles (Illumina). A blank extraction kit control ...
-
bioRxiv - Immunology 2021Quote: ... The 5’ gene expression libraries were sequenced following 10X Genomics read length guidelines on the NovaSeq6000 sequencer (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Systems Biology 2022Quote: ... were lysed and transposed simultaneously in 25 µl of transposition mix (0.1% NP40, 0.1% Tween-20, 0.01% digitonin and 5% Tn5 enzyme (Illumina # 15027865) in Tagment DNA Buffer (FC-121–1030 ...
-
bioRxiv - Systems Biology 2023Quote: ... approximately 5×104 cells were lysed and transposed reactions were carried out using Tn5 Transposase (Illumina, #FC121-1030) at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... Fastq files for 5′ libraries sequenced with the extended R1 strategy were generated using bcl2fastq v2.20.0 (Illumina, Inc). Extended R1 fastqs were then separated into “pseudo R1” fastqs ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were then sequenced with a depth of 5 million of reads using a NextSeq 500 System (Illumina).
-
bioRxiv - Cell Biology 2024Quote: ... The amplified DNA was then pooled to a 10 nM final concentration followed by a 5% PhiX (Illumina) spike and sequenced in a PE100 run on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... 5 PCR-cycles for the addition of indexes) according to manufacturer’s instructions (Illumina, Inc., San Diego, CA, USA). The final library pool was quantified by qPCR (Mascher et al ...
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...