Labshake search
Citations for Illumina :
1 - 50 of 1827 citations for 4 5 5 5 Tetrafluoro 4 trifluoromethoxy pentan 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2024Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% PhiX loading control (Illumina).
-
bioRxiv - Genomics 2024Quote: ... with 5% PhiX spike-in (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... with 5% PhiX library control (Illumina). Autosmal ranged from 23X to 29X ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biochemistry 2024Quote: ... with 5% phiX (Illumina, FC-110-3001) was loaded to the sequencer ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...