Labshake search
Citations for Illumina :
101 - 150 of 1678 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... using the TruSeq SBS Kit v.3 (Illumina). An average of 75 million paired reads was generated per sample.
-
bioRxiv - Developmental Biology 2022Quote: ... 300pM of the pooled library was loaded onto a NovaSeq S1 flowcell (Illumina p/n 20012865), using the Standard Workflow loading conditions designated by the manufacturer and amplified by exclusion amplification (ExAMP ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA primers TS Primer-X (“X” stands for barcode index; CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAG AATTCCA, N=standard Illumina barcodes) and TS Primer-1 (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Neuroscience 2024Quote: Biomarker Core Facility at King’s College London for library preparation (single cell 3’ version 3 on a Chromium 10X instrument) and sequencing (Illumina NextSeq system).
-
bioRxiv - Genomics 2020Quote: ... 300×2 bp or 150×2 bp (Illumina, Inc., San Diego, CA).
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina, CA, USA). The two types of libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl transposase (Illumina), 10.5 μl nuclease-free water and 0.01% NP-40 ...
-
bioRxiv - Immunology 2021Quote: ... Group 2 (France, Illumina), Group 3 (North America ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 from Illumina libraries.
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, CA, USA). ASVs were inferred using DADA2 v ...
-
bioRxiv - Systems Biology 2021Quote: ... Libraries were then pooled in groups of 4 and sequenced on 4 lanes on a NextSeq500 sequencer (Illumina) using 10X Genomics recommended reads configuration.
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 2017 (n = 11) were prepared into two Illumina TruSeq LT libraries (Illumina, Inc. San Diego, CA), and sequenced on two Illumina NextSeq500 runs.
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Developmental Biology 2024Quote: ... library construction was immediately carried out using a Chromium Single Cell 3’ Reagent Kit (Version 3) and sequenced on an Illumina HiSeq 4000 or an Illumina NextSeq2000 (Illumina, cat no. 20040559) by the Technion Medicine Faculty Azrieli-Technion Genomics Center ...
-
bioRxiv - Microbiology 2024Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR using universal bacterial primer sets (5’-TCGTCGG-CAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGG-TATCTAATCC-3’) and sequenced using the MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were processed using QIIME2 (version 2020.2 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed either on Hiseq 2000 (2 × 100 or 2 × 150 paired-end reads) or Miseq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA) following the manufacturer ‘s instruction.
-
bioRxiv - Physiology 2021Quote: ... High-throughput genome sequencing was performed on a HiSeq 2500 (2 × 100 or 2 × 150 paired-end reads) or MiSeq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The 33 samples were combined into 2 pools and sequenced using 2 NovaSeq (Illumina) S4 200 cycle flow cells.
-
bioRxiv - Cell Biology 2020Quote: ... and D (v.2, Illumina) and sequenced on HiSeq4000 and NovaSeq6000 (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl Tn5 enzyme (Illumina), 0.25 μl 1 % digitonin ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 22M reads at Novogene (Beijing ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 17 M reads at Novogene (Beijing ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2) Detection from Illumina RNA-seq data through SL leader sequence trimming(43) ...
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Barcoded libraries of ten samples (4 treated, 4 untreated and two controls) were equimolarly pooled and sequenced on MiSeq (Illumina) using MiSeq v3 150 reagent kit (MS-102-3001 ...
-
bioRxiv - Genomics 2023Quote: ... coverage and eight additional female genomes (4 Asian and 4 African) at ~30× (1 lane of Illumina Hiseq X Ten) coverage using 10x Linked-Reads at HudsonAlpha Institute of Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... All other bulls (N = 3679) were genotyped at approximately 50,000 SNPs using medium density (MD) chips (e.g., the Illumina BovineSNP50 bead chip that comprises 54,001 (version 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array data (either Illumina human methylation27K array, n = 15 genomes; or Illumina human methylation450K array ...
-
bioRxiv - Physiology 2020Quote: Sequencing libraries (n=167) were prepared with the TruSeq Stranded mRNA HS kit (Illumina, San Diego, California, USA). The 2100 Bioanalyzer using the DNA 1000 kit (Agilent Technologies ...
-
bioRxiv - Genomics 2023Quote: ... 4 washes with PR2 buffer (PR2, Illumina MiSeq), and 6 minute incubation at 60°C with shaking followed by 4 washes was performed a total of 3 times ...
-
bioRxiv - Plant Biology 2023Quote: ... with the MiSeq reagent kit version 3 (600 cycles; Illumina). The reads were cleaned up using the cutadapt ver ...
-
bioRxiv - Genomics 2020Quote: ... 30 libraries (n=15 for each group) were constructed using the HiSeq Library Preparation kit (Illumina, San Diego, USA) and sequenced using Illumina NovaSeq™ ...
-
bioRxiv - Cancer Biology 2022Quote: mRNA libraries of the mouse melanoma tumor (n = 12) samples were prepared and sequenced using the HiSeq 2000 (Illumina). RNAseq data were processed by pyflow-RNAseq (Tang ...
-
bioRxiv - Zoology 2023Quote: ... construction using the ONT rapid barcoding kit (SQK-RBK004 or SQK-RBK110.96) or an Illumina MiSeq (n=257) using the Nextera XT Library Preparation kit (Illumina) following the manufacturers’ protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... All samples were pooled equimolarly and sequenced on a NextSeq 500 High Output v2.5 flowcell (Illumina p/n 20024906) using the Illumina NextSeq 500 sequencing instrument with a single-read configuration (75 bp) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed in 3 sequencing unit of NovaSeq 6000 (Illumina) (100-nt-length reads ...
-
bioRxiv - Immunology 2023Quote: ... dual-indexed 3’ DGE libraries were prepared using Nextera XT (Illumina) and sequenced to depth on the NovaseqS4 platform with a paired-end read structure (R1 ...
-
bioRxiv - Immunology 2023Quote: The 3’ adapters were ligated according to the TruSeq kit (Illumina) manufacturer’s instructions ...