Labshake search
Citations for Illumina :
401 - 450 of 1678 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Braf-mutant Schwann cells divert to a repair phenotype to induce congenital demyelinating neuropathybioRxiv - Developmental Biology 2024Quote: ... or on at 2*101 base-pairs on a NovaSeq 6000 (Illumina) (from hiPSC-derived SC).
-
bioRxiv - Immunology 2024Quote: ... samples were sequenced at 2×150 bp using NovaSeq 6000 system (Illumina).
-
bioRxiv - Evolutionary Biology 2024Quote: ... and sequenced on a HiSeq X (Illumina, paired-end 2 × 150 pb).
-
bioRxiv - Developmental Biology 2024Quote: ... Paired-end reads (2×150 nt) were generated by HiSeq 4000 (Illumina) at the UCSF Center for Advanced Technology (CAT ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing libraries were prepared using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced on an Illumina HiSeq 2000 sequencer (RRID:SCR_020132, v.4, Illumina, San Diego, California, USA) in 50 bp single-end mode by Genomics and Proteomics Core facility ...
-
bioRxiv - Microbiology 2022Quote: ... and diluted to 4 nM for sequencing on an Illumina MiSeq (Illumina, San Diego, CA, USA). A 500 cycle MiSeq Reagent kit v2 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in cleavage mix (MiSeq Nano kit v2 reagent 4) (Illumina MS-103-1003) for 6 min at 60 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NextSeq 500 instrument (Illumina) or NovaSeq instrument (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing libraries were prepared using the Chromium Single Cell 3’ v2 kit and sequenced on a HiSeq system (Illumina) at Institut Curie NGS facility ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 12 µl of extracted RNA was depleted of rRNA using Ribo-Zero Gold H/M/R (Illumina) and then reverse-transcribed using random hexamers and SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: 3′-scRNAseq was completed using Chromium Next GEM single cell 3′ GEM library and Gel bead Kit v3.1 (10x Genomics) and sequenced using a NextSeq 500 (Illumina) at Genomics Birmingham (University of Birmingham) ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by library preparation according to the manufacturer’s recommendations (Single Cell 3’ V3 assay) and sequencing on a HiSeq4000 instrument (Illumina). Libraries were de-multiplexed ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The full-length cDNA were synthesized using the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 and sequenced by Illumina HiSeq X Ten platform by Gene Denovo Biotechnology Co ...
-
bioRxiv - Physiology 2022Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NovaSeq 6000 (Illumina) with 26 bases for read1 and 98×8 bases for read2.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Immunology 2020Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina, San Diego, CA) to perform the sequencing.
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA sequencing was performed on an Illumina MiSeq at RBGK with version 3 chemistry (Illumina, San Diego, CA, USA) and ran for 600 cycles to generate 2 × 300 bp paired-end reads ...
-
bioRxiv - Pathology 2021Quote: ... Single cell transcriptome libraries of liver cells were prepared with Chromium Single Cell 3’ NextGEM Reagent Kit v3.1 (10X Genomics) to performed sequencing on NextSeq 550 (Illumina) and demultiplexing pipeline with CellRanger v5.0.0 (10x Genomics) ...
-
bioRxiv - Microbiology 2022Quote: ... Short-read sequencing of strain 3-1B was conducted on the Illumina MiSeq platform (Illumina, San Diego, CA, USA) using the NEBNext Ultra II FS DNA library prep kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The library was spiked with 10% of 12.5 pM PhiX and sequenced using 150 cycles of MiSeq version 3 chemistry (Illumina).
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared according to the manufacturer’s protocol using 10X Single-Cell 3’ v3.1 chemistry (10X Genomics, PN-1000128) and sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The snRNA-seq library were constructed with 10x Genomic protocol (Chromium Single Cell 3’ Reagent Kits v3.1User Guide) and sequenced by Illumina NovaSeq.
-
bioRxiv - Immunology 2023Quote: ... using the Chromium Single Cell Gene Expression Solution 3’ v2 (10x Genomics) and sequenced by the DNA Sequencing Facility (RRID: SCR_017759) using NovaSeq6000 (Illumina) with read lengths of 29-bp + 90-bp (Read1 + Read2) ...
-
bioRxiv - Microbiology 2023Quote: Metagenomic shotgun sequencing was performed at the Norwegian Sequencing Centre on two lanes of the HiSeq 3/4000 (Illumina) generating 150 bp paired-end reads in both lanes ...
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: ... before processing through the Chromium Next GEM Single Cell 3’ Reagent Kits V3.1 (10X Genomics) and sequenced on a Novaseq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... was constructed using the QuantSeq 3’ mRNA-seq FWD kit (Lexogen) and the UMI Second Strand Synthesis Module (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gel-in-beads and libraries were generated using Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10x Genomics) and sequenced using NovaSeq (Illumina). Cell Ranger 7.0.1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were submitted for 10x library preparation with v3.0 chemistry for 3’ single-cell sequencing on a NovaSeq 6000 (Illumina) at the Cancer Research UK Cambridge Institute.
-
bioRxiv - Cancer Biology 2024Quote: ... Single-cell libraries were generated using 10X Genomics Chromium Single-cell 3’ Library RNA-Seq Assays protocols targeting 8,000 cells from each fraction were sequenced on the NovaSeq sequencer (Illumina). The scRNA-seq data were analyzed with the Partek Flow software (Partek Inc) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were submitted for 10x library preparation with v3.0 chemistry for 3’ single-cell sequencing on a NovaSeq 6000 (Illumina) at the Cancer Research UK Cambridge Institute.
-
bioRxiv - Genetics 2024Quote: ... cDNA libraries were constructed using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD (Illumina, Lexogen GmbH, Vienna, Austria) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA sequencing was performed by the High Throughput Sequencing Core (CHOP) using a standard 3’ assay with the NovaSeq 6000 platform and S1 Reagent Kit v1.5 (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... ScRNA-seq libraries were prepared using the 10x Genomics Chromium Next GEM Single Cell 3′ Library Construction Kit V3.1 (CG000204. Generated libraries were sequenced on an Illumina HiSeq4000 for 150bp paired end reads ...
-
bioRxiv - Cell Biology 2024Quote: Generation of 3’ mRNA sequencing libraries was done according to manufacturer’s recommendations (Lexogen, 015-QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina, 081-UMI Second Strand Synthesis Module for QuantSeq FWD ...
-
bioRxiv - Cell Biology 2024Quote: ... with the Chromium Single Cell 3′ v.3.1 kit(10x Genomics, no. PN- 1000121) and sequenced on the NovaSeq 6000 platform (Illumina) to obtain around 50,000 reads per cell.
-
bioRxiv - Cancer Biology 2024Quote: Gene analysis was performed thanks to the GenoBird platform by 3’RNA-sequencing profiling using a NovaSeq 6000 (Illumina). The quality of raw sequence reads was assessed by FastQC ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were prepared using the 10x genomics chromium 3’ gene expression solution v3.1 and sequenced on a NovaSeq6000 (Illumina). Read counts were analysed using Seurat (v5) ...
-
bioRxiv - Genomics 2020Quote: ... De-multiplexing of RNA-Seq reads was conducted using bcl2fastq v.2 (Illumina). Both DNA-Seq and RNA-Seq reads were submitted to FastQC 51 for quality validation.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 × 36 base paired-end sequencing was performed with a NextSeq500 sequencer (Illumina) by Tsukuba i-Laboratory LLP (Tsukuba ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). Reads were mapped using STAR (v 2.5.2b ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). To obtain differential ATACseq peaks ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing had been performed by a 300*2 paired-end kit by Illumina MiSeq ...
-
bioRxiv - Genetics 2021Quote: ... and subjected to 2 × 50-bp paired-end sequencing on Hiseq XTen (Illumina).
-
bioRxiv - Genomics 2021Quote: ... Each batch was sequenced separately on 1-flowcell (2 lanes) HiSeq 2500 (Illumina) Rapid Mode platform with a single-end (1×50 bp ...