Labshake search
Citations for Illumina :
101 - 150 of 332 citations for 7 METHOXY CHROMAN 3 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Cell Biology 2021Quote: ... with RNA integrity number higher than 7 was used for library preparation using the TruSeq Stranded mRNA Library Preparation Kit (Illumina, San Diego, CA, USA) and sequenced on a NextSEq500 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... The pooled library was quality controlled via sequencing at a concentration of 1.7 pM with 35% PhiX on a NextSeq 500 using a mid-output v2 kit (single-end 75 nucleotides, Illumina, San Diego, CA, USA), resulting in an average sequencing depth of 1 million reads ...
-
bioRxiv - Genomics 2020Quote: ... Both re-pooled libraries were then sequenced at a final concentration of 1.7 pM with 25% PhiX on a NextSeq 500 using a high output v2 kit (single-end, 75 nucleotides, Illumina, San Diego, CA, USA), resulting in an average sequencing depth of 9 million reads (range 817 469 – 41.7 million reads).
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Microbiology 2022Quote: Our existing genomics workflow (incorporating sample receipt, nucleic acid extraction, library preparation, short-read sequencing (Illumina NextSeq or MiSeq), and quality control (QC ...
-
bioRxiv - Microbiology 2022Quote: ... The amino acid change was then filtered based on the P-value (<0.05) by removing the low frequency variants from Illumina sequence errors.
-
bioRxiv - Microbiology 2021Quote: ... The amino acid change was then filtered based on the P-value (<0.05) to remove the low frequency variants from Illumina sequence errors.
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2019Quote: Two overlapping IN-PCR regions corresponding to the 288 amino acids of HIV-1 IN were sequenced with the MiSeq NGS platform (Illumina). The amplicons were purified with Agencourt AMPure XP (Beckman Coulter ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Cell Biology 2021Quote: ... and 3 cycles of PCR for incorporation of unique dual indices (NEBNext multiplex oligos for Illumina) to the final libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... Both libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD from Illumina, following the standard protocol ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Both full-length and 3’ RNA- seq libraries were sequenced on a NextSeq 500 instrument (Illumina) with 5-10 x 106 aligned reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina) to perform the sequencing.
-
bioRxiv - Cell Biology 2019Quote: ... COX4I2 and 3’ end of ID1 (green fluorescently labelled BAC (RP5-857M17) provided by BlueGnome (Illumina)) and the 20q telomere probe the TelVysion 20q Spectrum Orange (Cat ...
-
bioRxiv - Genomics 2019Quote: ... The sequencing was conducted on the MiSeq reagent v.3 600 cycles (Illumina, San Diego, CA). The four genomes were assembled using ngs_mapper v1.5 ...
-
bioRxiv - Genomics 2021Quote: ... and dual-indexed 3’ digital gene expression (DGE) sequencing libraries were prepared using Nextera XT (Illumina). Libraries were sequenced on a NovaseqS4 or NovaseqS2 with a paired end read structure (R1 ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Genetics 2020Quote: ... 3 groups in total) and constructed using the Illumina TruSeq Stranded Small RNA Sequencing kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina) using a NovaSeq S1 flow-cell to a depth of at least 3.5 × 108 reads/timepoint.
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and 3 μg of the product was processed using the TruSeq RNA Sample Preparation Kit (Illumina). Purification of mRNA was performed using polyT oligo-attached magnetic beads ...
-
bioRxiv - Genomics 2023Quote: scRNA-seq library preparation was performed using 10x Genomics Chromium 3’ single cell library protocol (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.