Labshake search
Citations for Illumina :
1 - 50 of 332 citations for 7 METHOXY CHROMAN 3 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: Methyl-seq-captured libraries were sequenced using a Hiseq2500 device (Illumina), by applying paired-end 125bp reads ...
-
bioRxiv - Genomics 2021Quote: The TruSeq Methyl Capture Epic kit was a gift from Illumina. Sequencing libraries were prepared according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 7) DC3000 − A (Illumina only), 8 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Genetics 2019Quote: ... The coding and splice-site regions of genes susceptible to hereditary arrhythmia and cardiomyopathies(10) were sequenced for probands II:3 and III-7 using Illumina HiSeq2500 Analyzer (Illumina, San Diego, CA, USA)(11) ...
-
bioRxiv - Genetics 2024Quote: ... libraries were prepared using EpiGnome™ Methyl-Seq reagents (Illumina, Inc, San Diego, CA), index-tagged for multiplexing ...
-
bioRxiv - Genetics 2023Quote: ... The Illumina TruSeq Methyl Capture EPIC library prep kit (Illumina, Santa Clara, CA, USA) was used following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries from 7 independent SCL-exo experiments were sequenced on 7 lanes of a HiSeq 1500 (Illumina) by the GEH facility (Rennes ...
-
bioRxiv - Genomics 2021Quote: ... All DNA methylation data was generated using the TruSeq Methyl Capture EPIC kit (FC-151-1003, Illumina) according to manufacturer’s protocol [62] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 ng of ssDNA was used as input for the Epicenter EpiGnome™ Methyl-Seq Kit (Illumina, EGMK81312 ...
-
bioRxiv - Molecular Biology 2022Quote: Equimolar amounts of libraries for Enzymatic Methyl-seq were first sequenced on the iSeq 100 instrument (Illumina) using paired-end sequencing of 2x151 to assess both library and pooling qualities ...
-
bioRxiv - Genetics 2020Quote: ... Libraries were prepared with the Accel-NGS Methyl-Seq DNA Library Kit from Illumina (Cat No. 30096, Swift) and the sequencing was performed at Novogene (Hongkong ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Genetics 2020Quote: Whole genome bisulfite sequencing libraries were generated with the Accel-NGS Methyl-seq DNA Library Kit (Swift Biosciences) and sequenced on a HiSeq X10 (Illumina) in 150bp PE mode with PhiX spike-in to counteract low sequence diversity ...
-
bioRxiv - Cancer Biology 2022Quote: ... resistant and P12 cells of cell lines #3 and #9 was performed at the Genomics and Proteomics Core Facility of the German Cancer Research Center (GPCF DKFZ, Heidelberg) using the TruSeq DNA PCR-free Methyl protocol (Illumina) for library preparation ...
-
bioRxiv - Genomics 2023Quote: ... xGen Methyl-Seq Library kit was purchased from Integrated DNA Technologies and Nextera XT library prep kit was from Illumina, Inc.
-
bioRxiv - Systems Biology 2024Quote: ... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
bioRxiv - Microbiology 2022Quote: ... a SnakeMake pipeline to assemble sequencing data produced by Illumina (7). The pipeline integrates different quality control tools like FastQC (31 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cleaned using Sample Purification Beads from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina, #FC-151-1002) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Genomics 2022Quote: ... Whole genome bisulfite sequencing libraries were prepared (according to Accel-NGS Methyl-Seq DNA library Kit for Illumina protocol, Swift Biosciences) and sequenced in 150 bp paired-end reads by Novogene company.
-
bioRxiv - Plant Biology 2021Quote: ... Samples with a RIN value of > 7 were used for library preparation (Illumina TruSeq Stranded Total RNA kit ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Cancer Biology 2022Quote: ... Post-ligation cleanup proceeded according to Illumina’s instructions with 110 µL Sample Purification Mix from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina catalog # FC-151-1002). After purification ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Microbiology 2019Quote: ... mixed with the PhiX control library v3 (diluted to 7 pM; Illumina, San Diego, USA), and loaded on an Illumina MiSeq cartridge ...
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the 7 other libraries were single-end sequenced using 50 cycles on a HiSeq2500 sequencer (Illumina) at the IGBMC GenomEast Platform (Illkirch ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Genomic DNA (7 ng) from each sample was first fragmented using a partial Nextera reaction (Illumina, Inc), which also ligates short adapter sequences to the ends of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...