Labshake search
Citations for Illumina :
101 - 150 of 1131 citations for 6 Chloro 3 4 dihydro 4 methyl 3 oxo 2H 1 4 benzoxazine 8 carboxylic Acid d3 Methyl Ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... The additional 71 ASH donors were genotyped separately at 4,327,108 SNPs with the Infinium Omni5-4 v1.2 BeadChip (Illumina, California). We updated SNP identifiers based on Illumina annotation files (https://support.illumina.com/content/dam/illumina-support/documents/downloads/productfiles/humanomni5-4/v1-2/infinium-omni5-4-v1-2-a1-b144-rsids.zip ...
-
bioRxiv - Immunology 2022Quote: ... High-resolution 4-digit HLA typing was performed with the TruSight HLA v2 Sequencing Panel kit from Illumina according to the manufacturer instruction ...
-
bioRxiv - Microbiology 2022Quote: ... Six samples per condition containing 4 μg of total RNA were used for TruSeq mRNA library preparation (Illumina) after being treated with Globin-Zero Gold rRNA Removal Kit (Illumina) ...
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were pooled together and sequenced using 75bp paired-end chemistry across 4 lanes of a Hiseq4000instrument (Illumina) to achieve 10 million reads per sample ...
-
bioRxiv - Genomics 2024Quote: ... Equal molar concentration sequencing libraries were pooled and set in 4 sequencing lanes of a NextSeq500 equipment (Illumina) run to avoid possible batch effects (Li et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Genomics 2024Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Immunology 2024Quote: ... using the TruSeq SBS Kit v.3 (Illumina). An average of 75 million paired reads was generated per sample.
-
bioRxiv - Microbiology 2024Quote: ... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
bioRxiv - Molecular Biology 2022Quote: ... or purified chromosomes (2 x 106 pelleted at 10,000g for 10min at 4°C) were resuspended in 50 μl transposase mixture (25 μl Illumina TD buffer ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled into a 4 nM solution and sequenced on the Illumina MiSeq platform (Illumina; San Diego; CA) with a target sequencing yield of 500MB-1GB per virome.
-
bioRxiv - Neuroscience 2023Quote: ... 4 saline) were pooled at equimolar concentrations and run with 75 bp paired-end reads on the MiSeq (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Neuroscience 2024Quote: Biomarker Core Facility at King’s College London for library preparation (single cell 3’ version 3 on a Chromium 10X instrument) and sequencing (Illumina NextSeq system).
-
bioRxiv - Cancer Biology 2021Quote: ... The captured libraries were sequenced to achieve a mean unique coverage of at least 1000x using Illumina v.4 chemistry and paired-end 100-base pair (bp) reads (HiSeq, Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... The flow cell underwent cluster amplification and massively parallel sequencing by synthesis using Illumina v.4 chemistry and paired-end 100-bp reads (Illumina).
-
bioRxiv - Immunology 2021Quote: Paired-end RNA-Sequencing was performed on two independent biological replicates of 10 or 12 pooled 4-dpf larval zebrafish per genotypic group (nlrc3l mutants versus their siblings) by Illumina HiSeq 2×100 basepairs ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 4 pools were sequenced on the Illumina MiSeq using the 600-cycle MiSeq Reagent Kit V3 (Illumina). Each pool contained 3 identical samples to assess sequencing run variations.
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Microbiology 2020Quote: ... Libraries diluted to 4 nM were sequenced with NextSeq 500 High Output Kit v2 (75 cycles) on a NextSeq 500 (Illumina). Small RNA libraries have been submitted to the NCBI sequence read archive (SRA ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were then collected by centrifuging at 500 x g for 10 min at 4°C and nuclei were resuspended in 50 μL of transposition reaction mix [25 μL 2X TD buffer (Illumina), 16.5 μL PBS ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... 4 μg of total RNA from A549 cells was subjected to rRNA removal using the Ribo-Zero Gold kit (Illumina). cDNA sequencing libraries were then prepared using the SureSelect Strand-Specific RNA library preparation kit (Agilent Technologies ...
-
bioRxiv - Genomics 2020Quote: ... The normalised samples (4 nM) were denatured with 0.2 N NaOH and diluted 20 pM using pre-chilled Hybridisation Buffer (HT1) (Illumina, USA). The 20 pM transcriptome libraries were further diluted to 10 pM with pre-chilled HT1 buffer prior to whole transcriptome sequencing on a MiSeq platform.
-
bioRxiv - Genomics 2021Quote: Final samples for both inverse PCR and UMI-amplicons (concentration 4 nM) were sequenced as paired-end reads on HiSeq2500 and NextSeq500 sequencers (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: ... stage-matched comparisons comprising a total of 5 control and 4 Mesp1 KO embryos were ultimately re-pooled and sequenced together for deep sequencing on a NovaSeq6000 S4 lane (Illumina). All libraries were sequenced to depths of at least 24,000 median fragments per cell ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each pool was sequenced 100 bp single-end on two flow cells of a HiSeq2500 sequencer using the HiSeq SBS sequencing kit version 4 (Illumina). Sequencing was conducted in two separate HiSeq runs to yield enough coverage per sample and later combined ...
-
bioRxiv - Immunology 2024Quote: ... After centrifugation at 500ξ g for 5min at 4°C, the cell pellets were resuspended in tagmentation-mix (containing Tagment DNA buffer, Tagment DNA Enzyme (Illumina), Digitonin (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).
-
bioRxiv - Genomics 2023Quote: ... Lysate was centrifuged for 10 min at 500g at 4°C and then resuspended in transposition buffer (25 ul TD buffer and 2.5 ul TD enzyme (Illumina, 20034197), 16.5 ul PBS ...
-
bioRxiv - Genomics 2022Quote: ... We centrifuged at 500 x g for 10 minutes at 4°C and resuspended cells in the transposition reaction mix (25 µL 2X TD buffer (Illumina), 2.5 µL TDE1 Tn5 transposase (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was collected for 4 biological replicates within each cell line and libraries were prepared by TruSeq mRNA Library Prep (Illumina). The libraries were sequenced on the Illumina HiSeq 4000 platform ...