Labshake search
Citations for Illumina :
51 - 100 of 1131 citations for 6 Chloro 3 4 dihydro 4 methyl 3 oxo 2H 1 4 benzoxazine 8 carboxylic Acid d3 Methyl Ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Individual purified libraries were pooled into two six-sample equimolar pools containing the indexes 3-8 (NEBNext multiplex oligos for Illumina, set 1, E7335) and deep-sequenced at BGI on a HiSeq4000 (paired-end 100-bp reads).
-
bioRxiv - Genetics 2024Quote: ... and feature barcoding libraries were pooled at a 4:1:1 ratio and treated with Illumina Free Adapter Blocking Reagent (Illumina, #20024144). Sequencing of pooled libraries was carried out on a NextSeq 2000 sequencer (Illumina) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cleaned using Sample Purification Beads from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina, #FC-151-1002) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Genomics 2022Quote: ... Whole genome bisulfite sequencing libraries were prepared (according to Accel-NGS Methyl-Seq DNA library Kit for Illumina protocol, Swift Biosciences) and sequenced in 150 bp paired-end reads by Novogene company.
-
bioRxiv - Developmental Biology 2021Quote: ... 4 nM 10X scATAC-seq library was sequenced on a NextSeq500 platform (Illumina) using NextSeq 500/550 High Output Kit v2.5 (75 Cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 nM 10X scRNA-seq libraries were sequenced on a NextSeq500 platform (Illumina) using NextSeq 500/550 High Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Biophysics 2022Quote: ... The sequencing (Step 4) was performed using a Hi-Seq sequencer (Illumina, US) and the data was then filtered using the framing sequence ACAC with a quality score larger then 20 and analyzed (Step 5 ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 ATAC-seq libraries were sequenced per lane in HiSeq 2500 System (Illumina) to generate paired-end 50-bp reads ...
-
bioRxiv - Microbiology 2024Quote: ... DNA from the V3-4 region was amplified using a primer set (Illumina, San Diego ...
-
bioRxiv - Cell Biology 2022Quote: ... All CORALL generated libraries were sequenced in parallel on 4 Novaseq S4 lanes (Illumina). RNA sequencing libraries for the differential sedimentation speed based cell fractionation experiment were performed using QuantSeq 3’ mRNA-Seq kit (Lexogen ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were diluted to 4 nM and sequenced on a NextSeq 500 sequencer (Illumina) with a NextSeq 500 High-Output Kit v2 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were multiplexed and sequenced on 4 lanes of a Nextseq 500 sequencer (Illumina) with 3 sequencing runs ...
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-ligation cleanup proceeded according to Illumina’s instructions with 110 µL Sample Purification Mix from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina catalog # FC-151-1002). After purification ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Genomics 2020Quote: ... Multiple mate-paired libraries (3, 8, 12 and 16 kb) were also constructed using the Nextera Mate-Paired Library Construction kit (Illumina). Libraries were sequenced on the Illumina HiSeq 2500 sequencer using the Illumina TruSeq PE Cluster kit v3 and TruSeq SBS kit v3 (101 ...
-
bioRxiv - Genomics 2020Quote: RNA from a subset of human fetal (n = 3) and mouse (n = 8) cortex tissue samples was prepared with TruSeq Stranded mRNA Sample Prep Kit (Illumina) and subjected to 125bp paired-end sequencing using a HiSeq2500 (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Microbiology 2023Quote: ... a 4 nM library was sequenced on the Illumina Nextseq500 platform (Illumina, San Diego, CA) at the Radboudumc sequencing facility ...
-
bioRxiv - Systems Biology 2023Quote: ... allowing 4 lanes of 10x to be sequenced per NovaSeq S1 flow cell (Illumina #20028319) using a 28bp read 1 ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced on an Illumina HiSeq 2000 sequencer (RRID:SCR_020132, v.4, Illumina, San Diego, California, USA) in 50 bp single-end mode by Genomics and Proteomics Core facility ...
-
bioRxiv - Microbiology 2022Quote: ... and diluted to 4 nM for sequencing on an Illumina MiSeq (Illumina, San Diego, CA, USA). A 500 cycle MiSeq Reagent kit v2 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in cleavage mix (MiSeq Nano kit v2 reagent 4) (Illumina MS-103-1003) for 6 min at 60 °C ...
-
bioRxiv - Genomics 2020Quote: ... denatured and diluted to 4 pM before loading onto the MiSeq flow cell (Illumina Inc., United States). According to Illumina protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclei were then pelleted (1,000xg, 10min, 4°C) and transposed in 2.5µl Tn5 (Nextera Tn5 transposase, Illumina), 12.5µl TD reaction buffer and 10.5µl water for 40min at 37°C with rotation ...
-
bioRxiv - Genomics 2020Quote: ... The library was sequenced on 4 lanes of an Illumina HiSeq 1500 (Illumina Inc.; San Diego, CA), generating 450,132,548 reads which were subsequently trimmed to remove adapters and filtered for length and quality using FASTX-Toolkit v0.0.14 (available from http://hannonlab.cshl.edu/fastx_toolkit/) ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were diluted to 4 nM and sequenced on a NextSeq 500 Sequencing System (Illumina, California, USA) using NextSeq 500/550 High Output Kit v2 (150 cycles ...
-
bioRxiv - Genomics 2021Quote: ... The library pool was sequenced on all 4 lanes of an NovaSeq 6000 S4 flow cell (Illumina) for 150 bp paired end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... We observed less than 4% barcode swapping between the two barcodes (more than 96% of the Illumina sequencing reads contained correct endodomain and barcode pairs) ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons were calculated for their nano-molarity and diluted to 4 nM (see Illumina 470-2016-007-B) for HTS run on MiSeq sequencer using the Illumina MiSeq Reagent Kit Version 3 (600bp pair-ended) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before being diluted to approximately 4 nM for loading onto an Illumina MiSeq (Illumina, San Diego, CA, USA). An Illumina 500 cycle MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and 4 samples were combined into RNA-seq runs on the Illumina MiSeq platform (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2021Quote: ... The final libraries at the concentration of 4 nM were sequenced on NextSeq 500 platform (Illumina, CA, USA) using 75 bp paired-end sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg total RNA per sample were used for the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) to generate cDNA libraries according to the manufacturer’s protocol ...