Labshake search
Citations for Illumina :
101 - 150 of 863 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free), sequencing and quality checks were done by the Biomics sequencing platform of the Institut Pasteur (C2RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR amplification using Illumina sequencing adaptor primers (Illumina). Paired-end sequencing was performed on a Hi-Seq 2500 System (University of Georgia Genomics Core ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free) and sequencing was done on the C2RT Biomics platform of the Institut Pasteur (using short reads ...
-
bioRxiv - Genetics 2021Quote: ... the TruSeq DNA PCR-Free Library Preparation kit (Illumina) was employed to make a six-strain library ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification followed Earth Microbiome Project recommendations (“16S Illumina Amplicon Protocol ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were barcoded and sequenced utilizing MiSeq (Illumina) Nano kit v.2 as described in [84].
-
bioRxiv - Cancer Biology 2022Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [56] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Genomics 2023Quote: ... (2022) (TruSeq DNA PCR-free libraries sequenced on Illumina NovaSeq6000 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were sequenced with a MiSeq (Illumina) using the reagent kit v3 (PE 2x300 ...
-
bioRxiv - Microbiology 2024Quote: ... which was determined by PCR and confirmed by Illumina whole-genome sequencing for this study.
-
bioRxiv - Genetics 2023Quote: ... using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... purified transposed DNA was PCR amplified using Nextera (Illumina) i5 common adapter and unique i7 index adapters and NEBNext High Fidelity 2x PCR Master Mix for 5 cycles with the following program ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were prepared using TruSeq DNA PCR-Free (Illumina) and were sequenced with 150-base-pair paired end reads on an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse and forward amplicon PCR primers recommended by Illumina were used (16s Amplicon PCR Forward Primer= TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG ...
-
bioRxiv - Microbiology 2024Quote: ... with the TruSeq PCR-free library prep kit (Illumina) and the Sci clone next-generation sequencing (NGS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [82] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplicons were indexed by PCR using Nextera indexes (Illumina), quantified with Qubit dsDNA High Sensitivity Assay kit (Invitrogen) ...
-
bioRxiv - Bioengineering 2024Quote: ... Amplicons were indexed by PCR using Nextera indexes (Illumina), pooled in equimolar concentrations ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was conducted using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) on an RT-PCR system (Illumina Eco, California, USA). The primers used are listed in Table 1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: Library preparation and sequencing - DNA from 15 clones was used to prepare PCR-free paired-end sequencing libraries (Illumina DNA Prep PCR free) with an insert size of ∼300bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1μl of adaptors (1μl of a 1:250 dilution of Illumina stock solution), 2.5μl water and 1.5 ml of NEB Quick ligase (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pellet was resuspended in transposition solution containing 5 μL TDE1 (Illumina, 15027865) 25 μL 2x buffer (Illumina ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR products were subjected to sequencing library construction using the TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA). The libraries were loaded on a NovaSeq 6000 system (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... DNA was PCR-amplified with TruSeq dual indexing primers (Illumina) to generate Illumina compatible libraries ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by tailed-PCR using Nextera XT Index Primers (Illumina) (S1B Fig) ...
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were then quantified and sequenced using MiSeq (Illumina).
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification was performed in a 48 well plate (Illumina) on an Eco machine (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR amplicons were then sequenced on a NextSeq 500 (Illumina). Guide scores were calculated as median log2 fold change in the abundance between the initial and final population of that sgRNA similar to standard CRISPR screens ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary PCR was performed using Nextra XT index primers (Illumina). The secondary PCR condition was 95 °C (20 sec) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We used a Truseq DNA PCR-free LT kit (Illumina) for library preparation ...
-
bioRxiv - Microbiology 2022Quote: ... Purified PCR products were then sequenced on a HiSeq400 (Illumina) with single end 100 bp reads at a minimum read depth of 5 million reads/sample.
-
bioRxiv - Cell Biology 2023Quote: ... Amplified and gel purified PCR products were sequenced by Illumina HiSeq (Azenta) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were sequenced on a HiSeq 4000 instrument (Illumina) at 50bp reads to a depth of 30M reads per sample.
-
bioRxiv - Molecular Biology 2022Quote: ... PCR adapters from the Illumina Nextera DNA prep kit (Illumina) were selected and added to each sample along with PCR master mix ...
-
bioRxiv - Microbiology 2024Quote: ... After qRT-PCR (KAPA Library Quantification Kit Illumina® Platforms) to determine TraDIS library concentration ...
-
bioRxiv - Microbiology 2023Quote: ... PCR-enriched and barcoded with unique dual indexes (Illumina, 20027213) using six PCR cycles ...
-
bioRxiv - Microbiology 2023Quote: ... followed by PCR amplification using TruSeq-designed primers from Illumina guidelines ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR amplicons were purified and sequenced on a MiSeq (Illumina). Sequencing reads were mapped and the abundance of each sgRNA was measured ...
-
bioRxiv - Genomics 2023Quote: ... TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, USA) was used as per the manufacturer’s protocol for sequencing library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR adapters from the Illumina Nextera DNA prep kit (Illumina) were selected and added to each sample along with PCR master mix ...
-
bioRxiv - Genetics 2024Quote: ... PCR products of different loci were pooled and sequenced (Illumina NovaSeq 2 × 250 bp ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR amplicons were purified and sequenced on a NovaSeq (Illumina). Fastq files were analyzed using MAGeCK software ...
-
bioRxiv - Microbiology 2024Quote: ... Purified PCR products were then sequenced on a HiSeq400 (Illumina) with single end 100 bp reads at a minimum read depth of 5 million reads/sample ...
-
bioRxiv - Immunology 2024Quote: ... PCR products were multiplexed using nextera XT index kit (Illumina) and applied to an Illumina MiSeq platform using MiSeq reagent kit V3 or NextSeq 2000 platform using NextSeq1000/2000 P1 Reagents (600cycles ...
-
bioRxiv - Cancer Biology 2021Quote: ... TN5 transposase was added to the buffer solution (Nextera DNA-library preparation kit, Illumina, Cat# FC-121-1030 ...