Labshake search
Citations for Illumina :
51 - 100 of 863 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... Sequencing libraries were generated with purified PCR products using Illumina TruSeq DNA PCR-Free Library Preparation Kit (Illumina, USA) following manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Microbiology 2024Quote: ... The second PCR (adaptor PCR) was performed with limited cycles to attach specific sequencing Nextera v2 Index adapter (Illumina). After purification ...
-
Legionella relative abundance in shower hose biofilms is associated with specific microbiome membersbioRxiv - Microbiology 2023Quote: ... The second PCR (adaptor PCR) was performed with limited cycles to attach specific sequencing Nextera v2 Index adapter (Illumina). After purification ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... pre-amplified samples were used for TaqMan quantitative PCR which was performed on Eco Real-Time PCR System (Illumina) using gene specific primers purchased from Fluidigm (DELTAgene Assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 10μl of the tagmented chromatin was mixed with 2.5μl of Nextera PCR primer cocktail and 7.5μl of Nextera PCR master-mix (Illumina FC-121-1030) in low-binding PCR tubes ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... The final PCR products were purified with a PCR purification kit (MGmed) and sequenced using a MiniSeq sequencer (Illumina). Base editing frequencies from targeted deep sequencing data were measured using source code (https://github.com/ibs-cge2/prime_editor_analysis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... we performed 12 cycles of pre-amplification PCR and 12 cycles of index PCR and used 0.002 ul TDE1 Tn5 enzyme per cell (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products were purified using Expin™ PCR SV mini (GeneAll) and sequenced using a MiniSeq Sequencing System (Illumina). The results were analyzed using Cas-Analyzer (http://www.rgenome.net/cas-analyzer/ ...
-
bioRxiv - Neuroscience 2021Quote: ... Universal adapters were ligated followed by 10 cycles of PCR using Illumina PCR Primer Cocktail and Phusion DNA polymerase from Illumina. Subsequent library purification with Agencourt AMPure XP beads was validated with Agilent Bioanalyzer 2100 ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... The PCR products were purified using Expin™ PCR SV mini (GeneAll) and sequenced using a MiniSeq Sequencing System (Illumina). The results were analyzed using Cas-Analyzer (http://www.rgenome.net/cas-analyzer/) ...
-
bioRxiv - Microbiology 2021Quote: ... 50 ng of each amplicon was dual indexed in a 5-cycle PCR reaction using the PCR module and indexed primers from the Nextera kit (Illumina). Resulting libraries were purified on AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... Tagmented DNA fragments were enriched by 10 cycles of PCR amplification using PCR master mix and primers with the index from Illumina. Libraries were quantified by the KAPA SYBR fast quantitative PCR kit (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were purified using a PCR purification kit (Hokkaido System Science) and sequenced on a Next-Seq 500 (Illumina) system (75-bp single-end reads) ...
-
bioRxiv - Microbiology 2020Quote: ... the 309 bp sequence of the nodD coding region was amplified by PCR from the DNA extractions and the PCR products were sequenced by Illumina MiSeq 2×250 bp technology as described in Methods S5 ...
-
bioRxiv - Bioengineering 2023Quote: ... The DNA fragments around the crRNA target site were amplified by a two-step PCR with specific primer sets (Table S2) and Index PCR Primers mentioned in the manufacturer’s instructions (Illumina, USA). After gel purification ...
-
bioRxiv - Genetics 2023Quote: ... dsODN specific PCR products were used for indexing PCR using 2x Platinum SuperFi PCR Master mix and i5 primer: AATGATACGGCGACCACCGAGATC and i7 indexing primers (Illumina) following the cycling conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.33 μL of the PCR product was then used for a second PCR reaction to attach the TruSeq UDI (Illumina) indexes ...
-
Measuring carbohydrate recognition profile of lectins on live cells using liquid glycan array (LiGA)bioRxiv - Biochemistry 2023Quote: ... The clonal phage was PCR amplified using a protocol described in “PCR Protocol and Illumina sequencing” and analyzed by Illumina sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... Reactions were carried out using the Illumina Eco Real-Time PCR System and quantified with the Eco Real-Time PCR System Software EcoStudy (Illumina).
-
bioRxiv - Immunology 2024Quote: ... barcoded cDNA was amplified by PCR to generate enough mass for library construction (Nextera® PCR primers) (Illumina, CA, USA). Sequencing of the libraries was performed on HiSeq2500 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15 µL of cleaned-up PCR product from the first PCR and 10 µL Nextera DNA CD Indexes (96-well format from Illumina) for dual indexing ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... individual 100bp TruSeq DNA PCR-free libraries (Illumina) were sequenced with Illumina HiSeq 2500 high-throughput paired-end sequencing technology at the Lausanne Genomic Technologies Facility (GTF ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification was performed using Nextera primers (Illumina) to make the libraries for deep sequencing.
-
bioRxiv - Cancer Biology 2020Quote: ... The resulting PCR products were sequenced by Illumina Hiseq 4000 and evaluated based on the known sgRNA targets sequence.
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation (Illumina Shotgun TruSeq DNA PCR-free) and Illumina sequencing on a HiSeq X platform with a 150bp PE read length was performed by Macrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Paired-end libraries (Illumina TruSeq DNA, PCR-free) were made according to the standard Illumina protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The final PCR products were sequenced by Illumina MiSeq PE300.
-
bioRxiv - Genetics 2020Quote: ... single worm PCR products were analyzed by Illumina sequencing using 2×250 bp pair-end run ...
-
bioRxiv - Biochemistry 2021Quote: ... in an Eco Real-Time PCR System (Illumina). The following thermal cycling profile was used ...
-
bioRxiv - Cell Biology 2020Quote: ... All PCRs were pooled and sequenced by Illumina sequencing (Duke Center for Genomic and Computational Biology (GCB) ...
-
bioRxiv - Genetics 2021Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-Free kit (Illumina, San Diego, California, USA) and pooled samples sequenced on the HiSeq4000 platform (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... following Sequencing Protocol provided by Addgene (“Broad Institute PCR of sgRNAs for Illumina sequencing”). Next-generation sequencing was performed from the Molecular Pathology Genomics Core of Children’s Hospital Los Angeles using Illumina HighSeq 2500.
-
bioRxiv - Cell Biology 2023Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cDNA template was PCR amplified (Illumina barcoding) for 12 cycles and size selected to 225–350 bp length ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a unique indexed RNA PCR primer (Illumina) per reaction ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR products were sequenced using HiSeq2500 (Illumina) to generate 100 bp single-end raw reads ...
-
bioRxiv - Plant Biology 2024Quote: ... using an Eco Real-Time PCR system (Illumina). Analysis was performed using the ddCT method with the qRAT tool and limma statistical framework (Flatschacher ...
-
bioRxiv - Microbiology 2020Quote: ... 0.75 M sucrose) and R1804M Ready-Lyse lysozyme solution (Illumina, USA). After 15 minutes of incubation at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... the V3-V4 hypervariable region of the bacterial 16S rRNA gene pool of the DNA extracts was amplified by PCR using the pair of 341f/806r primers prior to sequencing of PCR products using a HiSeq 2500 sequencer (Illumina, USA). A detailed description of the wet-lab and dry-lab workflows can be found in Supporting Information S5.
-
bioRxiv - Immunology 2021Quote: ... Transposed DNA fragments were purified using Qiagen Mini- Elute Kit and PCR amplified using NEB Next High Fidelity 2x PCR master mix (New England Labs) with dual indexes primers (Illumina Nextera). Genomic Alignment of sequencing reads ...
-
bioRxiv - Plant Biology 2024Quote: ... After three rounds of PCR with specific primers (1stPCR: CARMA_3RACE and RTPXT, 2ndPCR: mXTf and mXTr, 3rd PCR: Illumina indexing primers) and cleaning each PCR reaction on AMPure beads ...
-
bioRxiv - Cell Biology 2023Quote: The PCR primers introduce the full-length adaptor sequence required for Illumina sequencing (for details see Illumina small RNA PCR primers). PCR was performed in 12.5 μL using half of the ranhexRT sample as a template [1× KAPA HiFi HotStart ReadyMix (KapaBiosystems KK2602) ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR for HRM analysis was performed in High Resolution Melt/DNA binding Dye/DNA/PCR with HRM Curve mode of the Eco real-time PCR system (Illumina Inc.). The PCR conditions were 94°C for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR amplification (TruSeq Nano Library Preparation Kit, Illumina). Samples generated with PC v2.0 and panel v4 also had unique molecular identifier (UMI ...
-
bioRxiv - Genetics 2020Quote: ... The first PCR used universal primers (without Illumina indexes) to amplify the barcodes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The 100 PCR samples were then sequenced by Illumina sequencing platform ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free), sequencing and quality checks were done by the Biomics sequencing platform of the Institut Pasteur (C2RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR amplification using Illumina sequencing adaptor primers (Illumina). Paired-end sequencing was performed on a Hi-Seq 2500 System (University of Georgia Genomics Core ...