Labshake search
Citations for Illumina :
101 - 150 of 1999 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Targeted RNAseq and Sample Tag libraries were sequenced on an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina) to a depth of approximately 40,000 reads and 10,000 reads per cell ...
-
bioRxiv - Immunology 2022Quote: ... whose lengths were about 600 base pairs were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina). Only read2 contained the sequence regarding the definition of T cell clones.
-
bioRxiv - Molecular Biology 2021Quote: ... The index sequences were defined by the combination of primers with TruSeq HT index 1 (D 7xx) and TruSeq HT index 2 (D 5xx) (Illumina). Index PCR was performed using KAPA HiFi HS ReadyMix (Kapa Biosystems ...
-
bioRxiv - Developmental Biology 2021Quote: ... We tested two different amounts of Tagment DNA TDE1 enzyme (1 and 2 μl in a 50 μl reaction volume) (Illumina) per sample ...
-
bioRxiv - Immunology 2022Quote: ... The library was sequenced on the NovaSeq 6000 with pair-end reads (26 bp for read 1 and 91 bp for read 2) (Illumina). Data available at accession number GSE195488.
-
bioRxiv - Molecular Biology 2022Quote: ... The generated libraries were amplified using the KAPA HiFi Hotstart Ready Mix and Nextera Index Kit 1 (i7) and 2 (i5) primers (Illumina). Amplified libraries were purified using a 0.65x AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Paired-End 51 bases (in addition: 8 bases for index 1 and 8 bases for index 2) setup using the NovaSeq 6000 instrument (Illumina). SP Flow-Cell was loaded at a final concentration in Flow-Lane loaded of 400pM and including 1% PhiX ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Single-reads 76 bases (in addition: 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 (Illumina) using the NextSeq 500 High Output Kit 75-cycles (Illumina ...
-
bioRxiv - Systems Biology 2024Quote: ... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
bioRxiv - Plant Biology 2023Quote: ... A single lane of HiSeq3000 was used for sequencing with 2×151 bp read length in presence of 1% PhiX (Illumina). A total of 296,241,916 reads was obtained.
-
bioRxiv - Immunology 2023Quote: ... TCR libraries were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina) using NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles ...
-
bioRxiv - Developmental Biology 2024Quote: ... Custom paired-end sequencing (read 1 = 15 bp; read 2 = 250 bp) was performed using the NovaSeq 6000 instrument (Illumina) by the Genomics Core at Van Andel Institute ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Biochemistry 2024Quote: ... with 5% phiX (Illumina, FC-110-3001) was loaded to the sequencer ...
-
bioRxiv - Immunology 2021Quote: ... Samples were sequenced on an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina, USA) to a depth of approximately 100,000 reads per cell ...
-
bioRxiv - Immunology 2021Quote: ... whose lengths were about 600 base pairs were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina, USA). Only read2 contained the sequence regarding the definition of T cell clones.
-
bioRxiv - Genomics 2024Quote: Both read 1 and read 2 files from each spatial region were mapped to the mm10 reference genome (source: Illumina igenomes) using the bowtie2 package (v2.5.1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the pool of plasmids for each library (inputs) was amplified using primers bearing sequences from Illumina (Read 1 and Read 2) and complementary to PT1 and down to Moe (Figure 1C) ...
-
bioRxiv - Genomics 2024Quote: We then pooled the original and targeted libraries at a 2:1 molar concentration and sequenced them together on a NovaSeq 6000 (Illumina, 20012850) with a S1 Reagent Kit v1.5 (200 cycles ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of total RNA was used with the TruSeq RNA Sample Prep Kit v.2 (Illumina, San Diego, CA, USA). The cDNA libraries were quantified by quantitative Real-Time PCR (qPCR) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA solutions of approximately ≥5 ng μL−1 were subjected to the tagmentation reaction using the Nextera DNA Flex Library Prep Kit (Illumina, San Diego, CA) was used at 1/40 scale of the provided protocol ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Cell Biology 2024Quote: ... spiked in with 5% PhiX Control v3 (Illumina) and sequenced on an Illumina Novaseq 6000 at a depth of ∼50,000 reads/cell with dual index ...
-
bioRxiv - Microbiology 2024Quote: The preparation of libraries from extracted nucleic acids was carried out using the Nextera XT kit (Illumina) with 15 amplification cycles and paired-end sequencing was performed on a NextSeq 550 device with the read length of 150 bp at each end ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Physiology 2024Quote: ... sequencing was performed on a NextSeq instrument (2×75bp 2×10) according to the manufacturer instructions (Illumina Inc.) Reads were trimmed and ribosomal RNA reads were removed ...
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...