Labshake search
Citations for Illumina :
101 - 150 of 1186 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μtagment DNA enzyme (Nextera, Illumina), l nuclease free water ...
-
bioRxiv - Immunology 2021Quote: ... 1 μl of transposase (Nextera, Illumina) was added and samples were incubated at 37°C for 10 minutes followed by two washes with low-salt buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... A 1% PhiX sequencing control (Illumina) was spiked in ...
-
bioRxiv - Molecular Biology 2020Quote: ... the NEBNext Ultra II DNA Library Preparation kit was used to generate libraries using 5-10 ng of input or immunoprecipitated DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina (Set 1, E7335 and Set 2, E7500)) ...
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Immunology 2020Quote: ... cells were lysed in lysis buffer for 1 minute and transposed with Tagment DNA Enzyme 1 (Illumina) for 30 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... we prepared n=40 sequencing libraries from 1µg total RNA per sample using Illumina® Stranded mRNA Prep kits with unique 5′ and 3′ index adapter pairs (IDT for Illumina® RNA UD Indexes, Set A). Libraries were PCR amplified for 10 cycles ...
-
bioRxiv - Genetics 2020Quote: ... using a bead-to-DNA ratio of 1:1 before high-throughput sequencing on the MiniSeq system (Illumina). Libraries were sequenced 1 × 75bp for a minimum coverage of 2 million read depth ...
-
bioRxiv - Genomics 2022Quote: ... Consensus LADs (between the Nanopore-DamID undiluted and 1:1/10 dilution and between the two Illumina replicates) were determined using intersectBed.
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Index 1: 8bp (Illumina i7 sample index); Read 2 ...
-
bioRxiv - Genomics 2021Quote: ... 0.4 µM oligo 1 (a truncated Illumina read 1 sequence followed by six random bases ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Read 1 sequence (excluding Illumina barcodes) was aligned to a short reference sequence of AAV9:
-
bioRxiv - Synthetic Biology 2022Quote: ... The Read 1 sequence (excluding Illumina barcodes) was aligned to a short reference sequence of AAV9 ...
-
bioRxiv - Microbiology 2024Quote: ... spiked with 1% phage cDNA (PhiX, Illumina) and tested on the Illumina iSeq 100 before being sequenced on two NovaSeq S4 flow cells for deep sequencing.
-
bioRxiv - Genomics 2021Quote: ... at a 1:1 ratio and constructed into sequencing libraries using TruSeq DNA Preparation Kit (Illumina Inc, California, US). Sequencing was carried out using Illumina MiSeq paired-end 2 × 300 bp and performed by the High-Throughput Sequencing Core Facility in Biodiversity Research Center in Academia Sinica.
-
bioRxiv - Genomics 2024Quote: ... Two libraries were pooled and sequenced on a NextSeq 550 using High Output Kit v2.5 (300 Cycles: 146 read 1, 18 index 1, 8 index 2, 146 read 2) (Illumina) according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 µL Nextera (Illumina). The reaction was stopped with 1% SDS and incubated at 72C for 10 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
bioRxiv - Developmental Biology 2020Quote: ... assays for size distribution and concentration prior to pooling the multiplexed libraries for single-end 1×51nt or 1×75 sequencing on the HiSeq 2500 or HiSeq 4000 System (Illumina). Libraries were sequenced to a depth of >20M uniquely aligned reads.
-
bioRxiv - Plant Biology 2020Quote: ... A total of 56 samples (Appendix 1) were sequenced together on one lane of 1×75bp NextSeq500 High Output (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sequence data were first converted into fastq format using bcl2fastq v2.17.1.14 with the following parameters --use-bases-mask=Y150,I13,I12,Y150 --minimum-trimmed-read-length=1 --mask-short-adapter-reads=1 --create-fastq-for-index-reads (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... using single end 63bp for Read 1 and 12bp for index 1 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were run on an Illumina Nextseq 550 instrument using the MetSeq Primer 1 (NuGEN) mixed with the Read 1 primer (Illumina) according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2024Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2021Quote: ... 12 assemblies were done: 1) baseline (Illumina only), 2 ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL 12.5 μM Nextera Ad1 primer (Illumina), 1 μL 12.5 μM Nextera Ad2 barcoded primer (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 µL of amplicon tagmentation mix (Illumina) in a final volume of 10 µL and incubated at 55 °C for 7 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Read 1 was read with primer HP6 (Illumina) with 3 dark cycles (first 3 bases of read 1 were not read) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries with 1 % spiked-in PhiX control (Illumina) were sequenced at the 75-bp paired end on a high output flow cell using an Illumina NextSeq550 instrument at a sequencing depth of ∼1 M reads per cell at the sequencing open lab of the German Cancer Research Center.
-
bioRxiv - Genetics 2024Quote: ... including (1) updating SNP alleles (convert from Illumina A/B alleles to the genetic A ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µL of 10 µM Nexterra N7XX (Illumina) primer ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...