Labshake search
Citations for Illumina :
51 - 100 of 1186 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Genetics 2020Quote: ChIP-seq and DNase-seq libraries were prepared from 1-5 ng ChIP DNA or DNase DNA samples using NEBNext Ultra II DNA library Prep Kit (Illumina). Libraries were sequenced on an Illumina NextSeq 500 with single-end or paired-end 75 bp reads.
-
bioRxiv - Genomics 2021Quote: ... Following immunoprecipitation with Dynabeads Protein G beads (invitrogen) in PCR tubes, samples were subject to Tagmentation (5 µl Tagmentation Buffer, 1 µl Tagmentation DNA Enzyme (Illumina), 19 µl Nuclease free water ...
-
bioRxiv - Systems Biology 2020Quote: ... Sequencing was performed using custom read primer oligo1210 (5’-CTTGTGGAAAGGACGAAACACCGGTAATTTCTACTCTTGTAGAT) (HPLC purified, Integrated DNA Technologies) using NextSeq 1 × 75 nt High Output reagents (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Use of 250 pg of cDNA with 1/5 reaction of Illumina Nextera XT kit (Illumina, San Diego, CA, USA). The length distribution of the cDNA libraries was monitored using DNA High Sensitivity Reagent Kit on the Perkin Elmer Labchip GX system (PerkinElmer ...
-
bioRxiv - Genetics 2021Quote: ... The bone and reference captured library pools were diluted to 1 pM with a 5% spike-in of PhiX Control V3 (Illumina) for sequencing on a NextSeq 550 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... the antibody barcode library was pooled at a ratio of 1:5 with the gene expression library and sequenced on a NextSeq 2000 (Illumina) to an average depth of 34,000 reads per cell.
-
bioRxiv - Cancer Biology 2023Quote: RNA-seq libraries were prepared with 0,5-1 µg of total high quality RNA collected from samples and the Illumina Stranded Total RNA Prep kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Molecular Biology 2024Quote: ... Individual purified libraries were pooled into two six-sample equimolar pools containing the indexes 3-8 (NEBNext multiplex oligos for Illumina, set 1, E7335) and deep-sequenced at BGI on a HiSeq4000 (paired-end 100-bp reads).
-
bioRxiv - Cancer Biology 2022Quote: ... using primers DCF01 5’-CTTGTGGAAAGGACGAAACACCG-3’ and DCR03 5’-CCTAGGAACAGCGGTTTAAAAAAGC-3’ and subjected to single-end 75 bp (SE75) high-throughput sequencing using a NextSeq550 (Illumina).
-
bioRxiv - Developmental Biology 2020Quote: ... and two different mate-pair libraries (3 kb and 5 kb) were prepared with a Nextera Mate Pair Library Prep Kit (Illumina). Sequencing libraries were run on the Illumina Hiseq 2500 sequencer with a read length of 150 bp ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... The rRNA-depleted samples were used for TruSeq Stranded RNA Sample Prep kit to produce 5′ to 3′ strand-specific cDNA libraries (Illumina). A TruSeq SBS sequencing kit version 3 (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Molecular Biology 2024Quote: ... purified and ligated to 3′ and 5′ RNA adapters derived from TruSeq Small RNA Library Preparation Kit (Illumina, San Diego, CA, USA). Small RNA libraries were created using TruSeq Small RNA Library Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Cell Biology 2024Quote: ... were pooled at a 1:1:1:etc ratio before sequencing on an Illumina NextSeq 500/550 instrument using a version 2 kit (Illumina). Fastq files were generated for each library in Illumina BaseSpace ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA solutions of approximately ≥5 ng μL−1 were subjected to the tagmentation reaction using the Nextera DNA Flex Library Prep Kit (Illumina, San Diego, CA) was used at 1/40 scale of the provided protocol ...
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% of PhiX (Illumina) was used as run control ...
-
bioRxiv - Neuroscience 2021Quote: ... a forward primer 5′-CTT TCC CTA CAC GAC GCT CTT CCG ATC TAC GGR AGG CAG CAG-3 (28-nt Illumina adapter (in bold) followed the 14 nt broad range bacterial primer 343F ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA fragments were end-paired and phosphorylated at the 5’ end and successively adenylated at the 3’ end (following Illumina paired-end protocols), and the libraries ligated to the precapture adaptor were amplified and indexed via PCR ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Developmental Biology 2024Quote: ... Pooled libraries with unique 5′ and 3′ index adapter pairs were sequenced on an NextSeq 2000 P3 flow cell (Illumina®: San Diego, CA) to generate 66M (±12M ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of forward and 1 μl of reverse 25 μM PCR primers (Illumina), and 0.5 μl of Phusion high-fidelity DNA polymerase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... collected with the magnet and resuspended in 24ul of Tagmentation Mix (1:1 Illumina 2× Tagmentation buffer ...
-
bioRxiv - Immunology 2021Quote: ... Group 1 (The Netherlands, Illumina), Group 2 (France ...
-
bioRxiv - Microbiology 2021Quote: ... 1×75 cycles (Illumina, USA). Image analysis was performed in real time by the NextSeq Control Software and Real Time Analysis running on the instrument computer ...
-
bioRxiv - Systems Biology 2022Quote: ... 1% PhyX spike-in (Illumina) was added then pooled ...
-
bioRxiv - Immunology 2024Quote: ... 1 µL of TDE1 (Illumina), 0.25 µL of 5% digitonin (Promega) ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 ng of PCR-1 product was used as template with TruSeq indexing primers (Illumina) and 10 cycles of PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Genomics 2024Quote: ... Miniaturization involved testing libraries at 1/6th (IDT mini) or 1/8th (Roche mini, Illumina mini) of reaction volume tailoring input DNA to each kit between 24-45 ng total (Table 2) ...