Labshake search
Citations for Illumina :
101 - 150 of 1179 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).
-
bioRxiv - Genomics 2023Quote: ... Lysate was centrifuged for 10 min at 500g at 4°C and then resuspended in transposition buffer (25 ul TD buffer and 2.5 ul TD enzyme (Illumina, 20034197), 16.5 ul PBS ...
-
bioRxiv - Genomics 2022Quote: ... We centrifuged at 500 x g for 10 minutes at 4°C and resuspended cells in the transposition reaction mix (25 µL 2X TD buffer (Illumina), 2.5 µL TDE1 Tn5 transposase (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was collected for 4 biological replicates within each cell line and libraries were prepared by TruSeq mRNA Library Prep (Illumina). The libraries were sequenced on the Illumina HiSeq 4000 platform ...
-
bioRxiv - Molecular Biology 2024Quote: ... and finally diluted to 1.5 pM before loading at a low cluster density (4 x 105 clusters / mm2) together with 50% of PhiX spike-in (Illumina). For libraries sequenced on NextSeq extra purification and removal of adapter dimers was performed using SPRIselect beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... were pelleted at 500 g for 10 minutes at 4°C in a fixed angle centrifuge and resuspended in 50 μL transposition buffer (prepared from Illumina kit components TD buffer and 100 nM transposase [Illumina] ...
-
bioRxiv - Neuroscience 2024Quote: ... were pelleted at 500 g for 10 minutes at 4°C in a fixed angle centrifuge and resuspended in 50 μL transposition buffer (prepared from Illumina kit components TD buffer and 100 nM transposase (Illumina) ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... The libraries prepared were sequenced using the FLO-MIN106 (R9.4) flowcells on PromethION 24 (P24) Nanopore platform and following the paired-end sequencing workflow of Illumina HiSeq2000 platform (Illumina, USA) (Supplementary Method).
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were pelleted (500xg, 10 min, 4 °C) and tagmented with the Nextera DNA Library Prep Kit (Illumina, FC-121-1030) for 1 h at 37 °C ...
-
bioRxiv - Zoology 2020Quote: ... or 70 bp (Exp#4) RNA sequencing (RNAseq) was performed on Illumina HiSeq 2000 platform (Illumina, Inc., San Diego, CA, USA) from libraries construed as has been described in previous report (Zhang et al. ...
-
bioRxiv - Genomics 2023Quote: ... A total of 4 µg of RNA per sample was subjected to rRNA depletion using the RiboZero Plant Leaf kit (Illumina, MRZPL1224) following the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-10 ng of the full-length cDNA was used as input for preparing Nextera XT (Illumina, cat. # FC-131-1024) libraries following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The 16S rRNA gene V3-V4 regions were amplified (4) followed by addition of Illumina sequencing barcoded adaptors (Illumina, CA, USA.). The libraries were normalized and pooled for multiplex sequencing using the Illumina MiSeq v3 600 cycles cartridge (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... A total of 4 µg of RNA per sample was subjected to rRNA depletion using the RiboZero Plant Leaf kit (Illumina, MRZPL1224) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA input ranging from 64.4 ng – 1000 ng was used to initiate the Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Illumina 20040525) library preparation ...
-
bioRxiv - Immunology 2024Quote: ... One library consisting of a total of 4 samples were pooled and sequenced on the NextSeq 2000 (Illumina, San Diego, CA) using a P3 100 cycle kit (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries were prepared from 1 ng gDNA using the Nextera XT Library Preparation Kit v.3 (Illumina) and sequenced on the Illumina NextSeq system (paired end 2 x 150 bp insert size) ...
-
bioRxiv - Cell Biology 2024Quote: ... were pooled at a 1:1:1:etc ratio before sequencing on an Illumina NextSeq 500/550 instrument using a version 2 kit (Illumina). Fastq files were generated for each library in Illumina BaseSpace ...
-
bioRxiv - Genetics 2021Quote: ... Individual libraries were pooled in equimolar ratio (4 nM for each) and sequenced with the Nextseq 550 platform (Illumina, San Diego, California) in a single end 75 cycles high output run ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries were diluted from 26.2 nM (HBA1) and 33.4 nM (HBA2) to a concentration of 4 nM and pooled for sequencing on a MiSeq (Illumina, San Diego, CA).
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were diluted to a final concentration of 4 nM and sequenced with the NextSeq 500/550 HighOutput Kit v2.5 (75 cycles, Illumina, cat. no. 20024906), with 75 bp reads and pair-end sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% of PhiX (Illumina) was used as run control ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Microbiology 2024Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR using universal bacterial primer sets (5’-TCGTCGG-CAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGG-TATCTAATCC-3’) and sequenced using the MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were processed using QIIME2 (version 2020.2 ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.4 μg total RNA was used for RNA-seq library construction by a TruSeq RNA Library Prep Kit V2 (Illumina, RS-122-2001). Both ChIP-seq and RNA-seq libraries were sequenced at the Bauer Core Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... and centrifuged at 500 g at 4° C to isolate nuclear pellets that were treated in 50 μL reactions with Nextera Tn5 Transposase (Illumina, FC-121-1030) for 30 min at 37° C ...
-
bioRxiv - Genomics 2021Quote: ... The PCR products (4 nM from every single cell) were treated with the Miseq Reagent Kit v2 50 Cycles (Illumina KK, Tokyo, Japan) and sequenced by the MiSeq sequencer (26 bp ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products (4 nM from every sample) were treated with the MiSeq Reagent Kit v2 (50 cycle format; Illumina KK, Tokyo, Japan) and sequenced using the MiSeq Sequencer (26 bp ...
-
bioRxiv - Microbiology 2022Quote: ... for amplicon sequencing of the V3-4 hypervariable region of the 16S rRNA gene (position 341-806) on a MiSeq desktop sequencing platform (Illumina, San Diego, CA) operated under paired-end mode ...
-
bioRxiv - Microbiology 2022Quote: ... for amplicon sequencing of the V3-4 hypervariable region of the 16S rRNA gene (position 341-806) on a MiSeq desktop sequencing platform (Illumina, San Diego, CA) operated under paired-end mode ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Genetics 2023Quote: ... and 4 μl of bisulfite-converted DNA was measured on the Illumina HumanMethylation450 array using the manufacturer’s protocol (Illumina, San Diego, CA, USA). Preprocessing and normalization of the data were done using DNAmArray workflow previously developed by our group (https://molepi.github.io/DNAmArray_workflow/) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg total RNA was used to prepare RNA-seq libraries using the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, US). Strand specific paired-end mRNA sequencing was performed on DNBSEQ platform at the Next-Generation Sequencing Core of the BGI Genomics Service (Hong Kong ...
-
bioRxiv - Plant Biology 2024Quote: ... A Qubit 2.0 Fluorometer was used to calculate RNA concentration and 4 mg of total RNA was used to prepare libraries with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, US). Single-end sequencing (50bp ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was tagmented in 5 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then lysed and fragmented in a single reaction (12.5 µl 2X Illumina TDE buffer, 2.5 µl 1% Tween-20, 2.5 µl 0.2% Digitonin, 5 µl water, 2.5 µl Illumina TDE1 enzyme). Samples were incubated at 37°C for 60 minutes and purified using the Zymo DNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of forward and 1 μl of reverse 25 μM PCR primers (Illumina), and 0.5 μl of Phusion high-fidelity DNA polymerase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... collected with the magnet and resuspended in 24ul of Tagmentation Mix (1:1 Illumina 2× Tagmentation buffer ...