Labshake search
Citations for Illumina :
51 - 100 of 1179 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Libraries were multiplexed and sequenced on 4 lanes of a Nextseq 500 sequencer (Illumina) with 3 sequencing runs ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Microbiology 2023Quote: ... a 4 nM library was sequenced on the Illumina Nextseq500 platform (Illumina, San Diego, CA) at the Radboudumc sequencing facility ...
-
bioRxiv - Systems Biology 2023Quote: ... allowing 4 lanes of 10x to be sequenced per NovaSeq S1 flow cell (Illumina #20028319) using a 28bp read 1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified PCR products were pooled 1:1 and a 5% PhiX DNA spike-in was included and sequenced by Illumina HiSeq PE150 platform at Novogene ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequenced on an Illumina HiSeq 2000 sequencer (RRID:SCR_020132, v.4, Illumina, San Diego, California, USA) in 50 bp single-end mode by Genomics and Proteomics Core facility ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in cleavage mix (MiSeq Nano kit v2 reagent 4) (Illumina MS-103-1003) for 6 min at 60 °C ...
-
bioRxiv - Microbiology 2022Quote: ... and diluted to 4 nM for sequencing on an Illumina MiSeq (Illumina, San Diego, CA, USA). A 500 cycle MiSeq Reagent kit v2 (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genomics 2020Quote: ... denatured and diluted to 4 pM before loading onto the MiSeq flow cell (Illumina Inc., United States). According to Illumina protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclei were then pelleted (1,000xg, 10min, 4°C) and transposed in 2.5µl Tn5 (Nextera Tn5 transposase, Illumina), 12.5µl TD reaction buffer and 10.5µl water for 40min at 37°C with rotation ...
-
bioRxiv - Genomics 2020Quote: ... The library was sequenced on 4 lanes of an Illumina HiSeq 1500 (Illumina Inc.; San Diego, CA), generating 450,132,548 reads which were subsequently trimmed to remove adapters and filtered for length and quality using FASTX-Toolkit v0.0.14 (available from http://hannonlab.cshl.edu/fastx_toolkit/) ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were diluted to 4 nM and sequenced on a NextSeq 500 Sequencing System (Illumina, California, USA) using NextSeq 500/550 High Output Kit v2 (150 cycles ...
-
bioRxiv - Genomics 2021Quote: ... The library pool was sequenced on all 4 lanes of an NovaSeq 6000 S4 flow cell (Illumina) for 150 bp paired end reads ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Immunology 2023Quote: ... We observed less than 4% barcode swapping between the two barcodes (more than 96% of the Illumina sequencing reads contained correct endodomain and barcode pairs) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons were calculated for their nano-molarity and diluted to 4 nM (see Illumina 470-2016-007-B) for HTS run on MiSeq sequencer using the Illumina MiSeq Reagent Kit Version 3 (600bp pair-ended) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before being diluted to approximately 4 nM for loading onto an Illumina MiSeq (Illumina, San Diego, CA, USA). An Illumina 500 cycle MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and 4 samples were combined into RNA-seq runs on the Illumina MiSeq platform (Illumina, San Diego, CA).
-
bioRxiv - Genomics 2021Quote: ... The final libraries at the concentration of 4 nM were sequenced on NextSeq 500 platform (Illumina, CA, USA) using 75 bp paired-end sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg total RNA per sample were used for the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) to generate cDNA libraries according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Six samples per condition containing 4 μg of total RNA were used for TruSeq mRNA library preparation (Illumina) after being treated with Globin-Zero Gold rRNA Removal Kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were pooled together and sequenced using 75bp paired-end chemistry across 4 lanes of a Hiseq4000instrument (Illumina) to achieve 10 million reads per sample ...
-
bioRxiv - Genomics 2022Quote: ... The additional 71 ASH donors were genotyped separately at 4,327,108 SNPs with the Infinium Omni5-4 v1.2 BeadChip (Illumina, California). We updated SNP identifiers based on Illumina annotation files (https://support.illumina.com/content/dam/illumina-support/documents/downloads/productfiles/humanomni5-4/v1-2/infinium-omni5-4-v1-2-a1-b144-rsids.zip ...
-
bioRxiv - Immunology 2022Quote: ... High-resolution 4-digit HLA typing was performed with the TruSight HLA v2 Sequencing Panel kit from Illumina according to the manufacturer instruction ...
-
bioRxiv - Genomics 2024Quote: ... Equal molar concentration sequencing libraries were pooled and set in 4 sequencing lanes of a NextSeq500 equipment (Illumina) run to avoid possible batch effects (Li et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... or purified chromosomes (2 x 106 pelleted at 10,000g for 10min at 4°C) were resuspended in 50 μl transposase mixture (25 μl Illumina TD buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled into a 4 nM solution and sequenced on the Illumina MiSeq platform (Illumina; San Diego; CA) with a target sequencing yield of 500MB-1GB per virome.
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 saline) were pooled at equimolar concentrations and run with 75 bp paired-end reads on the MiSeq (Illumina).
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Cancer Biology 2021Quote: ... The captured libraries were sequenced to achieve a mean unique coverage of at least 1000x using Illumina v.4 chemistry and paired-end 100-base pair (bp) reads (HiSeq, Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... The flow cell underwent cluster amplification and massively parallel sequencing by synthesis using Illumina v.4 chemistry and paired-end 100-bp reads (Illumina).
-
bioRxiv - Immunology 2021Quote: Paired-end RNA-Sequencing was performed on two independent biological replicates of 10 or 12 pooled 4-dpf larval zebrafish per genotypic group (nlrc3l mutants versus their siblings) by Illumina HiSeq 2×100 basepairs ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 4 pools were sequenced on the Illumina MiSeq using the 600-cycle MiSeq Reagent Kit V3 (Illumina). Each pool contained 3 identical samples to assess sequencing run variations.
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Microbiology 2020Quote: ... Libraries diluted to 4 nM were sequenced with NextSeq 500 High Output Kit v2 (75 cycles) on a NextSeq 500 (Illumina). Small RNA libraries have been submitted to the NCBI sequence read archive (SRA ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were then collected by centrifuging at 500 x g for 10 min at 4°C and nuclei were resuspended in 50 μL of transposition reaction mix [25 μL 2X TD buffer (Illumina), 16.5 μL PBS ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... 4 μg of total RNA from A549 cells was subjected to rRNA removal using the Ribo-Zero Gold kit (Illumina). cDNA sequencing libraries were then prepared using the SureSelect Strand-Specific RNA library preparation kit (Agilent Technologies ...
-
bioRxiv - Genomics 2020Quote: ... The normalised samples (4 nM) were denatured with 0.2 N NaOH and diluted 20 pM using pre-chilled Hybridisation Buffer (HT1) (Illumina, USA). The 20 pM transcriptome libraries were further diluted to 10 pM with pre-chilled HT1 buffer prior to whole transcriptome sequencing on a MiSeq platform.
-
bioRxiv - Genomics 2021Quote: Final samples for both inverse PCR and UMI-amplicons (concentration 4 nM) were sequenced as paired-end reads on HiSeq2500 and NextSeq500 sequencers (Illumina).
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).
-
bioRxiv - Genomics 2023Quote: ... Lysate was centrifuged for 10 min at 500g at 4°C and then resuspended in transposition buffer (25 ul TD buffer and 2.5 ul TD enzyme (Illumina, 20034197), 16.5 ul PBS ...
-
bioRxiv - Immunology 2024Quote: ... After centrifugation at 500ξ g for 5min at 4°C, the cell pellets were resuspended in tagmentation-mix (containing Tagment DNA buffer, Tagment DNA Enzyme (Illumina), Digitonin (Promega ...