Labshake search
Citations for Illumina :
1251 - 1300 of 1335 citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA libraries were prepared using the 10X Genomics 3’mRNA-seq workflow (10X Genomics) and sequenced using a NovaSeq instrument (Illumina). Data was processed using CellRanger (10X Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were processed using the Chromium Next GEM Single Cell 3’ Reagent Kits (10x genomics) and sequenced on a NovaSeq 6000 (Illumina) at the Harvard Medical School Biopolymers Core Facility as 28 (read 1 ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Genomics 2023Quote: ... Micro-C libraries (at least 3 per each biological replicate) that passed QC criteria were pooled and paired-end sequenced on a NovaSeq6000 platform (Illumina) to >600 million read pairs per replicate ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell RNA libraries were prepared according to the 10x Genomics Chromium Single Cell 3′ Reagent Kits v2 User Guide and sequenced (paired-end) on a HiSeq 4000 (Illumina).
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 3) DNA Sequencing and Genomics Laboratory (BIDGEN): Libraries were prepared using the Nextera™ DNA Flex Library Preparation Kit (Illumina) and sequenced on a NovaSeq6000 to generate 2 x 150 bp reads ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification was carried out using 3 µl of NMP per sample and adding 1 µl of each dual-indexed (i7 and i5; Illumina) primer ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 µl of sample were used to generate single cell RNA-Seq libraries by following the Illumina Bio-Rad SureCell WTA 3’ Library Prep Guide (Illumina, San Diego CA and Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: ... was used for a tagmentation reaction that included 3 µL of 2X TMP buffer and 0.5 µL of Transposome (BLT; CAT # 20015880, Illumina Inc.), incubated in a thermocycler at 53 ℃ for 30 minutes with the lid set at 80 ℃ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... RNA libraries were prepared using QuantSeq 3’-mRNA Library Prep Kit (Lexogen) and RNA-seq was performed with the NovaSeq 6000 (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lexogen) and samples were sequenced on the HiSeq4000 (Illumina) in single read mode at the Genomics Core (KU Leuven) ...
-
bioRxiv - Pathology 2024Quote: ... The cDNA libraries were prepared using a Chromium Single Cell 3’ V3 kit (10X Genomics, USA) according to the manufacturer’s instructions and then sequenced on a NovaSeq6000 (Illumina, USA). Raw sequencing reads were aligned to the mm10 (GENCODE vM23/Ensembl 98 ...
-
bioRxiv - Immunology 2021Quote: SNP-array copy number profiling and analysis of regions of homozygosity were performed on DNA isolated from WT and CRISPR-Cas9 edited LCLs (ERAP2-KO) according to standard procedures using the Infinium Human CytoSNP-850K v1.2 BeadChip (Illumina, San Diego, CA, USA). Samples were scanned using the iScan system (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Genomics 2023Quote: ... and patient-derived LCLs was used for SNP-array copy number profiling and analysis of regions of homozygosity with the Infinium Human CytoSNP-850K v1.2 BeadChip (Illumina, San Diego, CA, USA). This array has ∼850,000 single nucleotide polymorphisms (SNPs ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries (1.3 nM) were chemically denatured and applied to an Illumina NovaSeq flow cell using the NovaSeq XP chemistry workflow (Illumina-20021664). Following transfer of the flowcell to an Illumina NovaSeq instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of total RNA were used as input for QuantSeq (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina; Lexogen) following the autoQuantSeq automated workflow ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x 105 mESCs and 5 x 104 S2 cells were resuspended in Tagment DNA Buffer and treated with 3 µL TDE1 Tagment DNA Enzyme (Illumina 20034197). After thorough mixing ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the scRNA-seq libraries were constructed by using the Chromium Next GEM Single Cell 3’ Reagent Kits v3 (10X Genomics, USA) and sequenced by using the sequencer Novaseq6000 (Illumina, USA). All procedures were following the manufacturer’s protocol.
-
bioRxiv - Genomics 2019Quote: DNA was extracted and genotyped from a total of 867 samples (START mothers) using the Illumina Human CoreExome-24 and Infinium CoreExome-24 arrays (Illumina, San-Digeo, CA, USA). Data was cleaned using standard quality control (QC ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA sequencing libraries were generated according to the manufacturer’s instructions for the TruSeq totalRNA with RiboZero Human/Mouse/Rat Gold (Illumina, San Diego, CA, United States). Sequencing was then performed on the NovaSeq6000 (Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Construction of DNA libraries was performed by the Michigan Department of Health and Human Services using the Nextera XT library prep kit (Illumina, San Diego, CA, USA) followed by sequencing on the MiSeq (Illumina ...
-
bioRxiv - Genetics 2024Quote: ... Bisulfite-converted DNA samples were randomly assigned to a chip well on the Infinium Human Methylation EPIC v2 BeadChip (Illumina, Inc., San Diego, CA) or in the Human Imprintome array BeadChip (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... was shipped on dry ice to the UCLA Neurogenomics Core facility (Los Angeles, CA) for analysis using Illumina HT-12 v4 human microarrays (Illumina Inc., San Diego, CA). The order of the sections was randomized prior to shipment to avoid confounding potential technical artifacts with potential biological gradients of gene expression ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we combined 3 μl of each sample (approx 2.24 ng) with a small quantity of a Nextera™ tagment DNA enzyme (Illumina catalogue #15027865). To decrease costs ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were sequenced using an Illumina MiSeq with MiSeq Reagent Kit v.3 (2x 300 bp, Illumina, San Diego, CA, USA) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...