Labshake search
Citations for Illumina :
1051 - 1100 of 1394 citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation was analysed on 850000 CpGs with the Infinium Human MethylationEPIC Kit (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... rRNA depletion was performed with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by a TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2024Quote: ... rRNA depletion was conducted with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by a TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA sequencing was performed at BCM Human Genome Sequencing Center using NovaSeq 6000 platform (Illumina). The raw fastq files were first quality checked using FastQC v0.11.8 software (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were generated using TruSeq® Stranded Total RNA Library Prep Human/Mouse/Rat (20020597, Illumina). Sequencing reads with 75 bp paired ends were generated on an Illumina HiSeq 2500 platform following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Molecular Biology 2021Quote: ... ribosomal RNAs were removed by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224). Then ...
-
bioRxiv - Genomics 2020Quote: ... microRNA expression profiling was performed using the human v2.0 microRNA Expression BeadChip (Illumina, Inc., San Diego, Calif) with 1146 microRNAs covering 97% of the miRBase 12.0 database according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... Total RNA was depleted from ribosomal RNA using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat, Illumina) followed by cDNA library preparation as described below.
-
bioRxiv - Neuroscience 2022Quote: ... All samples were depleted of ribosomal RNA using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina) (replicates 1-3 and cycloheximide treated ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were prepared using the Agilent SureSelect XT Human All Exon + UTR (v8) kit followed by Illumina NovaSeq 6000 150 cycle paired end sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... mRNA expression levels were extracted from microarray analyses performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Microbiology 2021Quote: ... Host ribosomal depletion was performed using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Paired-end transcriptome sequencing was generated on the HiSeq2500 platform (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA samples were treated with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and used for RNA-Seq library preparation using an Illumina TruSeq Stranded Total RNA Library Prep Kit (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Global methylation analysis was performed using the Illumina Infinium Human Methylation27 BeadChip (Illumina, Inc. San Diego, CA). Data quality was verified using in vitro methylated DNA (IVD ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Genetics 2021Quote: ... and iPSC-derived neural progenitor cells (NPC-FGF) was assessed using the Infinium Human Methylation EPIC BeadChip (Illumina), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples that met the Illumina TruSeq Stranded Total RNA (Human/Mouse/Rat) (Illumina Inc., San Diego, CA,USA) sample input guidelines were prepared according to the kits protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reads were confirmed to be post-quality control by Prinseq and mapped to the human donor sequence (hCoV-19/Germany/BavPat1/2020|EPI_ISL_406862|2020-01-28) using BWA (Illumina) and Pomoxis mini_align (Minion) ...
-
bioRxiv - Neuroscience 2019Quote: ... 332 cells from eight adult human brains (three males and five females) were collected and profiled by Illumina MiSeq and Illumina NextSeq 500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array data (either Illumina human methylation27K array, n = 15 genomes; or Illumina human methylation450K array ...
-
bioRxiv - Genomics 2022Quote: ... the samples were applied following the Illumina Infinium Human Methylation DNA chip manufacturer protocols (Illumina, San Diego, CA). Chips were analyzed using the Illumina Hi-Scan system at the McDonnell Genome Institute (MGI ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μg of total RNA were treated with the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat; Illumina). Depleted RNA was precipitated 1h at −80°C in three volumes of ethanol plus 1 μg of glycogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was depleted of ribosomal RNA using Ribo-Zero rRNA Removal Kit (Epicentre/Illumina, Human/Mouse/Rat) and library preparation was completed using NEBNext® Ultra Directional RNA Library Prep Kit for Illumina® (New England Biolabs) ...
-
bioRxiv - Neuroscience 2021Quote: Analysis of pluripotency gene expression profile was performed using the Human-HT-12-v4 expression BeadChip Kit (Illumina) and subsequent Pluritest analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... and stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina), following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Raw sequencing reads were aligned to the hg19 human genome with the Basespace RNA-Seq Aligment application (Illumina). GO-term enrichment was performed using Biojupies (44) ...
-
bioRxiv - Cell Biology 2022Quote: We identified genes with significantly differential transcript levels following the RSEM-EBSeq workflow outlined at http://deweylab.github.io/RSEM and used the sequences and annotation of UCSC human genome v19 (hg19) from Illumina igenome ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA was removed from total RNA using the Ribo Zero Gold for human/mouse/rat kit (Illumina). Using the TruSeq RNA Sample Library Preparation v.2 kit (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: ... Pair-end reads of cDNA sequences were aligned back to the human genome (UCSC hg19 from Illumina iGenome) by the spliced read mapper TopHat (v2.0.4 ...
-
bioRxiv - Genomics 2023Quote: ... and stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina), following manufacturer’s instructions.
-
bioRxiv - Systems Biology 2022Quote: ... the alignment of RNA-seq reads against the human reference genome (NCBI build37.2, downloaded from iGenome of Illumina) was performed using TopHat2 (version 2.0.13 ...
-
bioRxiv - Molecular Biology 2023Quote: Raw count data of 2700 PBMCs (PBMCs from a health human donor, single cell immune profiling dataset by Cell Ranger 1.1.0 on Illumina NextSeq 500 with ∼69,000 reads per cell ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 cycles of PCR for incorporation of unique dual indices (NEBNext multiplex oligos for Illumina) to the final libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... Both libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD from Illumina, following the standard protocol ...