Labshake search
Citations for Illumina :
1151 - 1200 of 1329 citations for Recombinant Human CD19 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... At least 50 ng of r-RNA depleted RNA was used to generate sequencing libraries using the True-seq small RNA library prep kit (Illumina). All libraries were barcoded and sequenced in parallel on a Next-seq platform for 400 million reads to obtain 75 bp single end reads.
-
bioRxiv - Genomics 2019Quote: The statistical package edgeR (Version 3.7) within the R software suite (Version 3.1) was used to analyse the RNA-seq (Illumina Hi-Seq) data and to identify transcripts significantly differentially expressed between P ...
-
bioRxiv - Genetics 2021Quote: ... the log R (LRR) intensity measurements and B allele frequency (BAF) for each sample at each probe were exported from Illumina’s Genome Studio software ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2×101 paired-end RNA-seq libraries were constructed using TruSeq stranded total RNA H/M/R prep kit and sequenced using the Novaseq6000 system (Illumina). Raw paired-end sequencing reads were mapped to the human genome (build hg38 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Cell Biology 2019Quote: ... The purified RNA samples were processed for preparations of cDNA libraries using the TruSeq Stranded Total RNA Ribo-Zero H/M/R (Illumina) and sequenced on HiSeq-2500 platform (Illumina ...
-
bioRxiv - Biochemistry 2019Quote: ... ribosomal (r)RNA was subtracted by hybridization from total RNA samples (100 ng total RNA input) using the RiboZero Magnetic Gold H/M/R Kit (Illumina). Following cleanup by precipitation ...
-
bioRxiv - Genomics 2019Quote: ... RNA-seq libraries were prepared from 100 ng of total RNA (obtained as described above for RT-qPCR) using the TruSeq Stranded Total RNA LT Kit with Ribo-Zero H/M/R (all Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Ribosomal RNA was subtracted by hybridization from total RNA samples using the RiboZero Magnetic Gold H/M/R Kit (Illumina) and the rRNA-subtracted samples were quantified with a Qubit 2.0 (RNA HS Kit ...
-
bioRxiv - Genetics 2021Quote: ... To assess genomic integrity of iPS lines we investigated the B-allele frequency and Log R ratio values of each iPS line which were downloaded from Illumina GenomeStudio ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 ng of total BH RNA with and without RNase R treatment was then used to construct cDNA libraries by Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Illumina 20072063) ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Immunology 2021Quote: ... and sequencing libraries generated with a TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina). Libraries were sequenced on a NextSeq500 platform (Illumina) ...
-
bioRxiv - Biophysics 2021Quote: ... libraries were constructed using Ribo-Zero Magnetic Gold Kit (Human) (Illumina, San Diego, CA, USA) and NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Systems Biology 2022Quote: ... Human DNA samples for the COVID study were subjected to the Infinium MethylationEPIC array (Illumina) at AKESOgen Inc. ...
-
bioRxiv - Genetics 2021Quote: ... we genotyped the genomic DNA with the OmniChip from the Human OmniExpressExome-8v1.2 from Illumina Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA samples were analyzed using Human HT expression BeadChip V4 (Illumina, San Diego, CA, USA). Raw data were processed using the bead array package from Bioconductor (16) ...
-
bioRxiv - Plant Biology 2023Quote: ... Library preparation included the “TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat”-kit (Illumina), ribosomal RNA depletion and a size selection step for 300 bp fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNAs were depleted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation patterns were evaluated by Infinium Human Methylation 850 K BeadChips (Illumina), which determine the methylation levels of 853,307 CpG sites ...
-
bioRxiv - Biophysics 2023Quote: ... we aligned the trimmed reads to the human reference genome (hg19, downloaded from Illumina’s iGenomes) using Hisat2 94 with “-k 1 –no-spliced-alignment –phred33” parameters and stored them as binary alignment maps (BAM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... stand-alone Ribo-Zero kits [Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat)] (Illumina), Ribo-Zero accompanied by a TruSeq Stranded Total RNA Kit (Illumina) ...
-
bioRxiv - Neuroscience 2020Quote: ... the nuclei-containing pellet was resuspended with 50 µl of the transposase reaction mix which contained 25 µl of the 2xTD reaction buffer and 2.5 µl of Tn5 Transposase (Nextera DNA Library Preparation Kit, Illumina, FC-121-1030; note: these reagents are now available in the Illumina Tagment DNA TDE1 Enzyme and Buffer Kit). Transposition was performed for 30 minutes at 37°C after which the transposed DNA was purified using MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... half of the samples had libraries prepared using the Accel-NGS kit (Washtenaw County, Michigan) and the other half using the Nextera XT kit (Illumina, San Diego, CA; cat# FC-131-1024). The 40 virome libraries were sequenced with Illumina HiSeq-1TB ...
-
bioRxiv - Plant Biology 2019Quote: ... R and Theta scores were extracted from resulting idat files using GenomeStudio Genotyping Module v2.0.2 (Illumina, San Diego, CA, United States) and allele scores were created using paRsnps (an in-house software package for clustering ...
-
bioRxiv - Cell Biology 2019Quote: ... All RNA samples were depleted for ribosomal RNA before library construction using Ribo-Zero™ Gold Kit H/M/R Kit (Illumina). Hi-Seq run of three independent biological replicates was performed on Illumina HiSeq2500 ...
-
bioRxiv - Genomics 2023Quote: ... These BAM files were quality checked by using systemPipeR’s alignStats function and subsequently a gene reads table was calculated by the summarzieOverlaps function of the GenomicAlignments (29) R/BioConductor package and the corresponding Gene Transfer Format (GTF) file (Illumina’s iGenomes). Normalization and detection of deregulated genes was performed using the DESeq2 v ...
-
bioRxiv - Genomics 2019Quote: ... and hybridized the samples to the Illumina Human Methylation 450K BeadChip array (Illumina, San Diego, CA), according to the manufacturers’ recommended protocols ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ribosomal RNA was depleted using the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and the RNA-seq library was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Bioengineering 2022Quote: ... Hybridization of 750ng of cRNA on Human HT-12 v4.0 Expression BeadChip (Illumina, BD-103-0604), were performed according to the manufacturer’s instructions ...
-
bioRxiv - Zoology 2021Quote: ... the ribosomal RNA was removed using the Ribo-Zero-Gold (Human–Mouse–Rat) Kit (Illumina, USA) and the Ribo-Zero-Gold (Epidemiology ...
-
bioRxiv - Systems Biology 2020Quote: ... Cohort 2 gene expression data were measured using a Human Ref-8 BeadChip array (Illumina, Inc) with ∼22k probes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) including a ribosomal RNA depletion step and sequenced on the Illumina HiSeq2500 platform (50 nt single-end reads).
-
bioRxiv - Microbiology 2022Quote: ... after first removing the host rRNA with a Ribo-Zero-Gold (Human–Mouse–Rat) kit (Illumina). Each library was sequenced as 100-bp paired-ends on the Novaseq 6000 S4 platform (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: Since the human epidemiological cohort data were generated on a different genomic platform (Illumina 450K array), we developed an imputation scheme for converting measurements between the two platforms ...
-
Coding and non-coding drivers of mantle cell lymphoma identified through exome and genome sequencingbioRxiv - Genomics 2019Quote: ... we used the Agilent SureSelect Human All Exon kits for library preparation and HiSeq2000 instruments (Illumina) for sequencing ...
-
bioRxiv - Immunology 2019Quote: ... Hybridization of the cRNA was performed on an Illumina Human-HT12 Version 4 chip set (Illumina). Microrarray data were exported from GenomeStudio (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... The sample was genotyped on the Illumina Human Core Exome Array (Illumina, San Diego, CA, US). GWAS QC was performed using standard methods and imputation was done using the HRC panel [63] on the Sanger Imputation server (https://imputation.sanger.ac.uk/) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DNA methylation was quantified using Infinium® Human Methylation 450K BeadChip (Illumina Inc.; San Diego, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained RNA was depleted of rRNAs with Ribo-Zero Gold Kit (Human/Mouse/Rat) kit (Illumina), separated in 17% Urea gel and stained with SYBR Gold (Invitrogen) ...
-
bioRxiv - Pathology 2021Quote: ... Ribosomal RNA depletion was carried out solely using the RiboZero Gold Human/Mouse/Rat kit (Illumina). Adapter sequences were based on the TruSeq small RNA sequences (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA sequencing was performed at BCM Human Genome Sequencing Center using NovaSeq 6000 platform (Illumina). The raw fastq files were first quality checked using FastQC v0.11.8 software (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was performed with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation was analysed on 850000 CpGs with the Infinium Human MethylationEPIC Kit (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Genomics 2024Quote: ... combined with methylation data collected from the public TCGA LUAD study (Illumina Human Methylation 450k BeadChip) (Supplementary Table 1) ...
-
bioRxiv - Genomics 2024Quote: Human islet RNA-seq libraries were prepared from total RNA using the stranded TruSeq kit (Illumina). ERCC Mix 1 or Mix 2 spike-ins were randomly added to each sample (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: The compressed paired-end human mRNA-seq data in fastq format over 80 gigabytes from Illumina PE150 ...