Labshake search
Citations for Illumina :
1051 - 1100 of 9025 citations for Human NADH ubiquinone oxidoreductase chain 5 MT ND5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: We acquired 212.66 GB clean reads for the 5’ gene expression library and 183.30 GB for the 5’ pcdhg expression library from the sequencing platform NovaSeq 6000 (Illumina, Novogene). 5’ gene expression sequencing data were aligned by Cellranger v3.0.2 (10X Genomics) ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicon library pool was diluted to 2 nM with sodium hydroxide and 5 mL were transferred into 995mL HT1 (Illumina) to give a final concentration of 10 pM ...
-
bioRxiv - Genomics 2021Quote: ... cDNA and barcode libraries were checked for quality on an Agilent 4200 TapeStation, quantified by KAPA qPCR, and sequenced on a single lane (95% transcriptome, 5% barcode) on Novaseq6000 (Illumina) to an average depth of 100,000 reads per cell.
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Genomics 2021Quote: ... Following immunoprecipitation with Dynabeads Protein G beads (invitrogen) in PCR tubes, samples were subject to Tagmentation (5 µl Tagmentation Buffer, 1 µl Tagmentation DNA Enzyme (Illumina), 19 µl Nuclease free water ...
-
bioRxiv - Systems Biology 2020Quote: ... Sequencing was performed using custom read primer oligo1210 (5’-CTTGTGGAAAGGACGAAACACCGGTAATTTCTACTCTTGTAGAT) (HPLC purified, Integrated DNA Technologies) using NextSeq 1 × 75 nt High Output reagents (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 5’ CGT ACA GCG GCT TGT TGG CTG TGA, and fA23M, 5’ GCG CTC CAG CTC CTT CTG CCC ATA, primers to which the Illumina sequencing primer sequences were attached to their 5’ ends) ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Cancer Biology 2022Quote: ... using primers DCF01 5’-CTTGTGGAAAGGACGAAACACCG-3’ and DCR03 5’-CCTAGGAACAGCGGTTTAAAAAAGC-3’ and subjected to single-end 75 bp (SE75) high-throughput sequencing using a NextSeq550 (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA from 28 samples in which scDNA-seq data showed at least 5% of homozygously mutated clones were analyzed by Illumina Omni2.5-8 SNP array ...
-
bioRxiv - Biochemistry 2019Quote: ... double indexed libraries (Nextera XT indices) were prepared from recovered library DNA from rounds 3–5 and sequenced on a MiSeq platform (Illumina) using a v3 chip as single 151 cycle reads37 ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were isolated from 100,000 cells and sequencing adapters were transposed for 30 minutes at 37°C using 5 μl of TDE1 (Nextera Tn5 transposase, Illumina). After PCR and gel purification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... TASSEL 5 GBS v2 pipeline (52) was used to perform the SNP calling of the sequence data obtained from Illumina sequencing ...
-
bioRxiv - Genetics 2021Quote: ... The bone and reference captured library pools were diluted to 1 pM with a 5% spike-in of PhiX Control V3 (Illumina) for sequencing on a NextSeq 550 (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified with AMPure XP purification kit and Sixteen-plexed samples were pooled in approximately equimolar amounts of 5 nM and run in a single and double index reads on a Hiseq 4000 (Illumina).
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Genomics 2023Quote: ... groups was based on 5 μg of total RNA according to the manufacturer’s protocol using the Illumina HiScanSQ Instrument (Illumina, USA) and sequenced in the same flow cell as paired-end (2 × 100 bp) ...
-
bioRxiv - Microbiology 2024Quote: ... All samples were pooled to a final concentration of 5-10 ng/µL and sequenced on a NextSeq 500 (Illumina). The demultiplexed data was assembled and SNPs detected with Pilon software using reference genome sequences.84
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Genetics 2023Quote: ... Plasma was divided from maternal peripheral blood (5[mL) by centrifuging and then 600[μL (Ion Torrent) or 1.4 mL (Illumina CN500) plasma was used to extract cell-free DNA ...
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Immunology 2024Quote: ... the antibody barcode library was pooled at a ratio of 1:5 with the gene expression library and sequenced on a NextSeq 2000 (Illumina) to an average depth of 34,000 reads per cell.
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR amplification (TruSeq Nano Library Preparation Kit, Illumina). Samples generated with PC v2.0 and panel v4 also had unique molecular identifier (UMI ...
-
bioRxiv - Plant Biology 2020Quote: ... Ribo-Zero kit (Epicentre, an Illumina company, Madison, WI) was used to remove rRNA from the libraries ...
-
bioRxiv - Microbiology 2020Quote: ... libraries were prepared using the Nextera XT kit (Illumina) at 1/12th reaction size with a TTP LabTech mosquito® HV liquid handling robot ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was removed using the Ribo-Zero kit (Illumina) and stranded RNA-seq libraries were prepared using random hexamer and NEB directional RNA library prep kit (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The TruSeq DNA Nano Sample Prep Kit v2 (Illumina) was used in subsequent steps of library preparations ...
-
bioRxiv - Molecular Biology 2021Quote: ... then treated with RiboZero Magnetic Gold (Yeast) Kit (Illumina) as described previously30 ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the NextSeq500/550 High Output v2.5 Kit (Illumina). The sequence reads were aligned against GRCh38 genome assembly using the cellranger count command of Cell Ranger (version 4.0.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1096 ...
-
bioRxiv - Developmental Biology 2021Quote: ... A Nextera XT DNA Library Preparation Kit (Illumina, Inc.) was used to generate indexed 2×75bp paired-end cDNA libraries for subsequent sequencing on NextSeq 500 sequencing platform (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were then generated using the Nextera kit (Illumina) and 75bp single end read-sequencing was carried out.
-
bioRxiv - Developmental Biology 2020Quote: ... using the Nextera DNA Flex library prep kit (Illumina) to create a library from full-length cDNA ...
-
bioRxiv - Genomics 2022Quote: Illumina’s TruSeq Stranded mRNA Library Prep Kit (#20020594, Illumina) was used on 500 ng of total RNA for the preparation of strand-specific sequencing libraries according to manufacturer’s guidelines ...
-
bioRxiv - Genomics 2022Quote: ... and used the TruSeq RNA Sample Preparation Kit (Illumina) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2019Quote: ... and quantified using the KAPA Library Quanti Kit (Illumina) Universal qPCR Mix (KAPA Biosystems ...