Labshake search
Citations for Illumina :
51 - 100 of 8720 citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Cell Biology 2019Quote: ... The purified RNA samples were processed for preparations of cDNA libraries using the TruSeq Stranded Total RNA Ribo-Zero H/M/R (Illumina) and sequenced on HiSeq-2500 platform (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... To assess genomic integrity of iPS lines we investigated the B-allele frequency and Log R ratio values of each iPS line which were downloaded from Illumina GenomeStudio ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Plant Biology 2019Quote: ... R and Theta scores were extracted from resulting idat files using GenomeStudio Genotyping Module v2.0.2 (Illumina, San Diego, CA, United States) and allele scores were created using paRsnps (an in-house software package for clustering ...
-
bioRxiv - Genomics 2023Quote: ... These BAM files were quality checked by using systemPipeR’s alignStats function and subsequently a gene reads table was calculated by the summarzieOverlaps function of the GenomicAlignments (29) R/BioConductor package and the corresponding Gene Transfer Format (GTF) file (Illumina’s iGenomes). Normalization and detection of deregulated genes was performed using the DESeq2 v ...
-
bioRxiv - Genomics 2024Quote: ... The trimmed reads were mapped separately to our reference genome using the tool bwa mem (-M-R’@RG\tID:$Population\tSM:$Individual\tPL:ILLUMINA’, v0.7.17, Li 2013). Low quality alignments were removed using samtools (-q 30-f 0×0002-F 0×0004-F0×0008 ...
-
bioRxiv - Microbiology 2020Quote: ... TruSeq SBS Kit v3-HS 50 cycles kit (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... Nextera XT Index Kit and Miseq Sequencing Kit (MiSeq Reagent Kits v2,300 cylce) were purchased from Illumina.
-
bioRxiv - Genomics 2022Quote: ... Tagmentation Kit (Illumina) following the Illumina reference guide instructions and recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation kit (Illumina). One ug of RNA was processed for each sample ...
-
bioRxiv - Genomics 2022Quote: ... kit (Illumina #20025523) by the University of Michigan Advanced Genomics Core ...
-
bioRxiv - Genetics 2023Quote: ... Ligation kit (Illumina), followed by 100 bp single-end sequencing on an Illumina NovaSeq 6000 SP system.
-
bioRxiv - Cell Biology 2022Quote: ... Ligation Kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... using either the using NextSeq 500/550 High Output v2.5 (150 cycles) Kit or the NovaSeq 6000 S2 Reagent Kit v1.5 (100 cycles) Kit (Illumina). The Illumina raw BCL sequencing files were processed through the CellRanger software (10x Genomics ...
-
bioRxiv - Genomics 2020Quote: ... using the TruSeq SBS Kit v3-HS 200 cycles Kit (Illumina). The raw RNA-seq reads (available at GEO GSE137895 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... The kit employed was TruSeq RNA Library Prep Kit v2 (Illumina) over polyadenylated RNA and the manufacturer’s instructions were followed ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... in the pair-end mode using HiSeq Rapid Pair-end Cluster Kit v2 and HiSeq Rapid SBS Kit v2 500 cycle kit (Illumina) reagents ...
-
bioRxiv - Immunology 2020Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3). Sequence analysis and assembly of lineage trees were performed using an in-house custom analysis pipeline as previously described (39 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and HiSeq SBS Kit V4 50 cycle kit (FC-401-4002, Illumina). NovaSeq 6000 paired-end sequencing was performed using 54 cycles for Read 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... v2 Kit (Illumina Inc.). Illumina novaSeq base call (BCL ...
-
bioRxiv - Cell Biology 2019Quote: ... v2 Kit (Illumina Inc.). Approximately 44*106 reads were obtained for each sample ...
-
bioRxiv - Genomics 2019Quote: Three kits from Illumina were tested with different total RNA input ...
-
bioRxiv - Microbiology 2019Quote: ... Nextera XT kit (Illumina) was used for library preparation and 2 × 150 bp paired-end sequencing was conducted on a MiSeq platform (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... and SBS kits (Illumina). Target read depths were ∼5-10 million raw reads per sample.
-
bioRxiv - Microbiology 2019Quote: ... and index kit (Illumina). Library validation was performed on a 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation kit (Illumina, Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... or nano kits (Illumina) depending of the DNA yield of the siolation process in any case using a more conservative 350bp insert size ...
-
bioRxiv - Cancer Biology 2023Quote: ... (M) Tagmentation Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Ligation kit (Illumina, Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Tagmentation Kit (Illumina, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... v2 Kit (Illumina Inc.), resulting in high-quality reads ranging from 11 to 17 million reads per sample (Table S3 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... ligation kit (Illumina, 20040532) according to the manufacturer’s instruction from 35 ng of RNA (except for macaque replicate_2 ...
-
bioRxiv - Genomics 2022Quote: ... Bulls were genotyped with either a medium-density SNP array (50K: BovineSNP50 Beadchip, Illumina Inc) or a high-density SNP array (HD ...
-
bioRxiv - Genomics 2021Quote: ... Most bulls were genotyped with a medium-density SNP array (50K: BovineSNP50 Beadchip, Illumina Inc) or a high-density SNP array (HD ...
-
bioRxiv - Genomics 2022Quote: ... Bulls were genotyped with either a medium-density SNP array (50K: BovineSNP50 Beadchip, Illumina Inc) or a high-density SNP array (HD ...
-
bioRxiv - Immunology 2023Quote: ... Medium-depth sequencing (50 million reads per sample) was performed with a NextSeq 550 (Illumina) on a High Output flow cell using 75 base pairs ...
-
bioRxiv - Genomics 2021Quote: ... Library preparation was carried out with the Nextera XT DNA Sample Preparation Kit and MiSeq Reagent Kit V2 Library Preparation Kit (Illumina Inc.). DNA was sequenced with Illumina MiSeq technology ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Plant Biology 2023Quote: ... from 100 to 1000 ng of total RNA using a stranded kit (Illumina TruSeq Stranded Total RNA Kit or NEB Next Ultra™ II Directional RNA Library Prep Kit for Illumina). The resulting data files contained paired end sequences (150 bp ...
-
bioRxiv - Developmental Biology 2019Quote: ... NGS Libraries were prepared from purified DNA from anti-zic2 ChIP (Zic2, IgG pre-immune serum) and input samples according to manufacturer instructions (Illumina). Libraries were single-end sequenced in HiSeq2000 apparatus using Flow Cell v3 chemistry (read length ...
-
bioRxiv - Bioengineering 2021Quote: ... using a NextSeq 500/550 High Output Kit v2.5 (75 Cycles) kit (Illumina). Sequencing was performed at the Genomics Research Unit ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the HiSeq 3000/4000 SBS Kit or TruSeq SBS Kit v4 (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... and Nextera XT DNA Library Preparation Kit and Nextera XT Index Kit (Illumina). Libraries were assessed using a High Sensitivity DNA Analysis Kit for the 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a TruSeq Kit mRNA Library Prep Kit (Illumina, San Diego, CA, USA) was used to prepare the strand-specific cDNA library for Illumina sequencing ...
-
bioRxiv - Genomics 2020Quote: ... Next-Generation Sequencing were carried out using MiSeq Reagent Kit v3 or MiSeq Reagent Kit v2 Micro or Miseq reagent Kit v2 Nano in Miseq system (Illumina Inc, USA) or using NovaSeq 6000 SP Reagent Kit (Illumina Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... with the « NEBNext® Ultra™ II DNA Library Prep Kit » kit (Illumina®). Paired-end sequencing was performed in on a HiSeq1500 (Illumina® ...
-
bioRxiv - Microbiology 2019Quote: ... machine with the NextSeq® 500 Mid Output Kit v2 kit (150 cycles) (Illumina), to generate read of 150 bp.
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Systems Biology 2023Quote: ... with a 300 bp paired-end reads sequencing kit (MiSeq Reagent Kit v3; Illumina). The raw data from the MiSeq instrument in the gz compressed FASTQ format were analyzed with several bioinformatics tools in the Linux operating system ...