Labshake search
Citations for Illumina :
751 - 800 of 1260 citations for Recombinant Rat Fc Fragment Of LgG Low Affinity IIb Receptor CD32 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... beginning at Elution 2 – Fragment – Prime step immediately preceding cDNA synthesis according to the manufacturer instructions (Illumina) with the following modifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... (4) The amplified fragments were sequenced on the Illumina HiSeq™ 4000 platform (Illumina, San Diego, USA) by Gene Denovo Biotechnology Co ...
-
bioRxiv - Molecular Biology 2021Quote: ... ChIP-derived DNA fragments were submitted for further manipulation by standard ChIP-seq library preparation techniques (Illumina) and Advanced Sequencing on an Illumina NextSeq 500 sequence analyzer as 75 bp single-end reads.
-
bioRxiv - Microbiology 2019Quote: ... and paired-end fragment libraries (∼1,000bp) were constructed using the Nextera XT DNA library preparation kit (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... to obtain 36 bp single-end fragments with a mean coverage 30.2X (13.7–44.0; electronic supplementary material, Table S1) by Illumina HiSeq 4000 at BGI ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Paired-end libraries of 2x150 bp fragments were prepared with TruSeq Nano DNA Library Prep Kits (Illumina), and sequencing was performed on a HiSeq3000 Illumina sequencer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Fragments enriched by capture hybridization were analyzed by high-throughput sequencing on a NovaSeq 6000 instrument (Illumina). TSO500 alignment and variant calling was performed using the TSO500 bioinformatics pipeline v2.1.0 ...
-
bioRxiv - Microbiology 2023Quote: ... An Illumina NextSeq sequencer was applied for generation of paired-end fragment reads (2 × 150 nucleotides) and bcl2fastq software (v2.17.1.14; Illumina) was applied for primary data analysis (base-calling) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 206 bp library fragment was generated using overlap PCR and included NexteraXT adapter overhang sequences (Illumina 16S Metagenomic Sequencing Library Preparation protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA libraries were constructed using the Takara SmartSeq for Ultra Low Input kit and sequenced using a HiSeq 2500 Sequencer (Illumina) 100 bp SR ...
-
bioRxiv - Cell Biology 2020Quote: ... and library enrichment were performed as described in the Low Throughput protocol of the TruSeq RNA Sample Prep Guide (Illumina). RNA libraries were assessed for quality and quantity with the Agilent 2100 BioAnalyzer and the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies) ...
-
bioRxiv - Genetics 2021Quote: ... Full-length cDNA was prepared using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing and sequencing libraries prepared using the Nextera XT DNA library preparation kit (Illumina). The resulting libraries were evaluated using a 4200 TapeStation (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... and germfree C57BL/6J mice were prepared using the Clonetech SMARTer Ultra Low Input library preparation kit combined with Nextera XT DNA sample preparation kit (Illumina) and sequenced with single-end 100 bp on a HiSeq2000 platform at the UNC High Throughput Sequencing Core Facility ...
-
bioRxiv - Genomics 2022Quote: ... The Illumina DNA shotgun library was prepared following the Nextera DNA FLEX low volume protocol with Nextera DNA Combinatorial Dual Indexes (Illumina) for insert sizes 300–350 bp ...
-
bioRxiv - Genetics 2019Quote: Raw reads were preprocessed with cutadapt v1.15 26 to trim potential low quality bases (-q 20 -m 25) and potentially remaining sequencing adapters (-a and -A option with Illumina TruSeq adapter sequences according to the cutadapt documentation ...
-
bioRxiv - Immunology 2021Quote: ... 1μg of RNA was used to prepare cDNA with the TruSeq RNA kit following the recommendations for low sample preparation protocol (Illumina). Samples were sequenced on an Illumina MiSeq instrument at a depth of 35×10^6 reads per sample ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were generated in 384-well format using a custom low-volume protocol based on the Nextera XT process (Illumina). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... adaptor ligation and library enrichment were performed as described in the Low Throughput protocol of the TruSeq RNA Sample Prep Guide (Illumina). RNA libraries were assessed for quality and quantity with the Agilent 2100 BioAnalyzer and the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... approximately 10ng of total RNA per sample was used for library construction with the Ultra-Low-RNA-seq RNA Sample Prep Kit (Illumina) and sequenced using the Illumina HiSeq 4000 instrument according to the manufacturer’s instructions for 100bp paired end read runs ...
-
bioRxiv - Neuroscience 2020Quote: ... approximately 85ng of total RNA per sample was used for library construction with the Ultra-Low-RNA-seq RNA Sample Prep Kit (Illumina) and sequenced using the Illumina HiSeq 2500 instrument according to the manufacturer’s instructions for 100bp paired end read runs ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA amplification was done using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Illumina, San Diego, CA, USA). A DNA library was prepared using the Nextera XT DNA Sample Preparation Kit (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: ... approximately 10 ng of total RNA per sample was used for library construction with the Ultra-Low-RNA-seq RNA Sample Prep Kit (Illumina) and sequenced using the Illumina HiSeq 4000 instrument according to the manufacturer’s instructions for 100bp paired end read runs ...
-
bioRxiv - Genetics 2022Quote: ... We estimated the endogenous human DNA content of each library with low coverage shotgun sequencing generated on iSeq 100 (Illumina) platform ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing libraries were generated in 384-well format using a custom low-volume protocol based on the Nextera XT process (Illumina). Sequencing reads were generated using a NovaSeq S4 flow cell or a NextSeq High Output kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All SAGs generated at SCGC were subject to Low Coverage Sequencing (LoCoS) using a modified Nextera library preparation protocol and NextSeq 500 (Illumina) sequencing instrumentation (Stepanauskas et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA libraries were constructed using the SMARTer universal low input RNA kit (Clonetech) and sequenced using a HiSeq 2500 Sequencer (Illumina) 100bp SR.
-
bioRxiv - Genomics 2022Quote: ... Illumina DNA shotgun libraries were prepared following the Nextera DNA FLEX low volume protocol with Nextera DNA Combinatorial Dual Indexes (Illumina) for fragment sizes 300–350 bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... NEBNext Low Input RNA libraries were prepared manually following the manufacturer’s protocol (NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® Instruction Manual Version 5.0_5/20 ...
-
bioRxiv - Physiology 2023Quote: ... Libraries were prepared using the Takara SMART-Seq v4 Ultra low input RNA kit and analyzed on a NovaSeq platform (Illumina) using paired-end (PE100/150 ...
-
bioRxiv - Evolutionary Biology 2024Quote: Illumina sequencing libraries for three amplified DNA samples were prepared using Nextera TruSeq DNA PCR-Free Low Throughput Library Prep Kit (Illumina). Subsequently ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and paired-end libraries were constructed according to the Illumina TruSeq DNA PCR-Free Low Throughput Library Prep Kit (Illumina). The four paired-end libraries were quantified by qPCR using the KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Physiology 2023Quote: ... 1 µg of total RNA was used as input for Truseq Stranded total RNA library preparation following the low sample protocol (Illumina). Sequencing was performed on the NextSeq2000 instrument (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... 85 ng of total RNA per sample was used for library construction with the Ultra-Low-RNA-seq RNA Sample Prep Kit (Illumina) and pair-end sequenced using the Illumina HiSeq 2000 instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were sequenced single-end using 50 bp reads on the HiSeq-2500 and Hi-Seq 4000 platforms (Illumina, San Diego, USA).
-
bioRxiv - Genetics 2022Quote: ... Final library concentrations were diluted to 4nM and submitted for sequencing on the Illumina Hi-Seq 2500 (Illumina, San Diego, CA, USA), 125bp SE in the GSL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cDNA libraries were singe-end sequenced in 76 cycles using a NSQ 500/550 Hi Output KT v2.5 (Cat #20024906 Illumina, San-Diego, CA) in one multiplex run (N=3/exposure group) ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15 nM with addition of 15% Phix control v3 (Illumina, FC-11-2003). The Illumina Mi-Seq post-run processing uses the barcoded indices to split all sequences by sample and generate FASTQ files ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then indexed using forward (i7) and reverse (i5) index primers from the Nextera Index Kit (Illumina FC-121-1011). Index ligation and fragment amplification were achieved using the method’s PCR amplification thermal cycling program.
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mono-nucleosomal DNAs were subjected to sequencing using a TruSeq DNA library prep kit (FC-121-2001, Illumina). The final libraries were sequenced using an Illumina HiSeq 2500 platform ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tagmentation of 600pg of cDNA is performed according to Nextera DNA sample preparation manufacturer instructions (Illumina, Inc., FC-131-1096) using a Truseq-P5 hybrid constant oligo (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Developmental Biology 2019Quote: ... quantification and Nextera library construction were done following the published ChIPmentation protocol (Schmidl et al., 2015) using indexed Illumina adapters (FC-121-1011, Illumina). Illumina adaptors were removed from the ChIP and ChIPmentation reads using Cutadapt (1.6 ...
-
bioRxiv - Systems Biology 2020Quote: cDNA was tagmented and amplified using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina, San Diego, CA). The manufacturer’s protocol was followed with the following modified reagent volumes and primers ...
-
bioRxiv - Immunology 2019Quote: ... and by enzymatic fragmentation of 300 pg of cDNA followed by 12 PCR cycles using the Nextera XT DNA Library Preparation Kit (cat# FC-131-1096, Illumina). Sequencing of the 15 mRNAseq libraries multiplexed together was carried out with an Illumina HiSeq2500 on a 2x125 bp paired-end run.
-
bioRxiv - Genomics 2019Quote: ... Each sample library was uniquely barcoded and quantified by PCR using a PhiX Control v3 (Illumina, Cat #FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15nM with the addition of 15% Phix Control v3 (Illumina, FC-11-2003) previously described by Shaukat et al ...
-
bioRxiv - Genomics 2020Quote: ... was performed on the instrument using HiSeq Rapid SBS Kit v2 (FC-402-4021) and HiSeq Rapid PE Cluster Kit v2 (PE-402-4002) (Illumina). Image analysis was performed using the HiSeq Control Software version 2.2.58 ...
-
bioRxiv - Genetics 2020Quote: ... The cell pellet was resuspended with 50 μl transposition mix containing 25 μl 2X TD buffer (Illumina FC-121-1030), 3.5 μl Tn5 transposase (Illumina FC-121-1030) ...
-
bioRxiv - Cell Biology 2021Quote: ... was performed by incubating beads with tagmentation buffer (12.5 µl 2 x TD buffer, 11.5 µl nuclease free water, 1µl Tn5 enzyme (Illumina #FC-131-1024)) at 37°C for 10min ...
-
bioRxiv - Genomics 2021Quote: ... The nuclei-enriched pellet was immediately used for transposition reaction using Nextera DNA Library Prep Kit (Illumina, FC-121-1030). The transposition reaction was incubated at 370C for 30 min and followed immediately by purification using QIAGEN MinElute Kit (Qiagen ...