Labshake search
Citations for Illumina :
601 - 650 of 1260 citations for Recombinant Rat Fc Fragment Of LgG Low Affinity IIb Receptor CD32 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... DNA fragments were sequenced on an Illumina HiSeq 2500 sequencer (Illumina, San Diego, CA, USA) using the paired-ended mode (2 × 100 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments were then amplified by PCR using Nextera index primer 1 and 2 (Illumina) and produced by PCR amplification (10–13 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were enriched for fragments >200 bp and sequenced on a NextSeq2000 instrument (Illumina) using v2 chemistry ...
-
bioRxiv - Genomics 2020Quote: ... Two μg of genomic DNA from each organism was subjected to indexed-tagged pair-end sequencing on an Illumina Hiseq 2000 platform (Illumina, CA, USA) to generate 100 bp paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... Each sample’s total DNA was fragmented and tagged with sequencing adapters using Nextera XT DNA Library Preparation Kit (Illumina, San Diego, CA). As previously described ...
-
bioRxiv - Developmental Biology 2021Quote: ... Adapters were trimmed and low quality sequences removed using trimmomatic and the requisite Illumina adapter sequences (trimmomatic v0.38; PE -threads 2 ILLUMINACLIP:Illumina_TrueSeq_Adapters_PE.fa:2:30:10 HEADCROP:1 MINLEN:31) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Libraries were prepared with the Low Sample TruSeq total RNA preparation protocol from Illumina (San Diego, CA, US) using 15 PCR cycles ...
-
bioRxiv - Genetics 2020Quote: ... before deep-sequencing libraries were subjected to low-pass sequencing (∼0.1 × genome coverage) by the MiSeq platform (Illumina). From this we visually assessed library quality by the uniformity of whole-genome amplification in 10 Mb bins ...
-
bioRxiv - Developmental Biology 2020Quote: Low-pass whole genome sequencing (depth of sequencing < 0.1x) libraries were prepared using the VeriSeq PGS Kit (Illumina) or the NEB Ultra II FS Kit and sequenced with the MiSeq platform as previously described (17 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we used contigs derived from the assembly of low-coverage next-generation sequencing (Illumina HiSeq platform; see below) of Crocus cartwrightianus ...
-
bioRxiv - Genomics 2021Quote: ... to obtain high-quality reads and minimize false genotyping results due to low-quality reads supplied by Illumina, we implemented the following quality control procedures to filter the reads before read mapping using Trimmomatic v0.36 (Bolger et al ...
-
bioRxiv - Microbiology 2023Quote: ... The libraries for MiSeq were prepared using the TruSeq DNA Sample Preparation Kit for low DNA input (Illumina). Sequencing was performed with the MiSeq Reagent Kit V3 (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina) workflow was used in genetic variant analyses ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were sequenced at low-pass (2x 50bp paired end) targeting 2 million reads on a NextSeq (Illumina) instrument ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Genomics 2020Quote: ATAC-seq was performed as previously described using the Nextera DNA Library Prep Kit (Illumina #FC-121-1030). First ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were then transposed for 30’ at 37’C with adapter-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and sequenced on an Illumina NextSeq 500 to generate 2x 75bp paired-end reads.
-
bioRxiv - Evolutionary Biology 2020Quote: ... from 1 μg DNA using the TruSeq PCRfree DNA sample preparation kit (FC-121-3001/3002, Illumina Inc.) targeting an insert size of 350 bp as directed ...
-
bioRxiv - Neuroscience 2019Quote: ATAC-seq libraries were prepared using the Tn5 transposase system (Nextera DNA library kit, Illumina, FC-121–1030) as previously described (23) ...
-
bioRxiv - Bioengineering 2021Quote: ... 570 μL of denatured library DNA and 30 μL of denatured PhiX control library (Illumina, FC-110-3001) were mixed ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were then transposed for 30 min at 37C with adaptor-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and Sequenced on an Illumina NextSeq 500 platform to generate 2 x 36-bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... Purified amplicons were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1001) using 1 ng of purified amplicon library per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... Full-length cDNA was then processed with a Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). This kit aims to fragment and add adapter sequences onto template DNA with a single tube Nextera XT tagmentation reaction and so generate multiplex sequencing libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-sequencing was performed using NextSeq75 High Output v2 kit and NextSeq 500 (Illumina; cat# FC-404-2005). Using TruSeq 3’ SE adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... A second PCR step was performed with Illumina Nextera XT Index Kit v2 (Illumina, Cat.:FC-131-2001) and Ex Taq DNA Polymerase (TaKaRa Bio ...
-
bioRxiv - Physiology 2022Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Plant Biology 2021Quote: ... the Tn5 reaction was prepared and mixed well with nuclei using the Nextera reagents (Illumina, FC-121-1030) as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... The full-length cDNA output was processed with Nextera XT DNA library preparation kit (Illumina #FC-131-1024) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended in the transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121-1030, Nextera), 2.5⍰μl Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Genomics 2019Quote: ... equivalent to the protocol in the Illumina TruSeq PCR-Free Sample Preparation Guide (Illumina cat# FC-121-2001). Center-specific details are available from the TOPMed website82 ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then prepared following the instructions of the TruSeq DNA Sample Preparation Kit (Illumina, #FC-121-2001) and sequenced on the HiSeq 2000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tagmentation and library preparation was performed using the Nextera XT DNA Library Preparation Kit (Illumina, Cat# FC-131) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Each sample library was uniquely barcoded and quantified by qPCR using a PhiX Control (Illumina, FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2021Quote: ... DNA libraries for whole genome sequencing were prepared with Nextera DNA Library Prep Kit (FC-121-1031, Illumina). Libraries for RADseq were prepared according to the procedures of Adapterama III74 with few modifications ...
-
bioRxiv - Genetics 2021Quote: ... and Illumina libraries were prepared with different indexes using Nextera XT Library Prep Kit (Illumina, FC-131-1096). Prior to sequencing ...
-
bioRxiv - Physiology 2021Quote: Sequencing libraries were prepared using the Illumina Nextera XT DNA Sample Preparation kit (Illumina, Ref. FC-131-1096) and the combination of 384 Unique Dual Indexes (Illumina-Set A to D ...
-
bioRxiv - Neuroscience 2020Quote: ... Approximately 50.000 nuclei were used for the transposition reaction using hyperactive Tn5 transposase (Illumina Cat #FC-121-1030) followed by 13 cycles of PCR amplification ...
-
bioRxiv - Immunology 2020Quote: ... the sequencing library was then created from cDNA using the Illumina Nextera XT method (Illumina FC-131-1096). All libraries were combined and sequenced on Illumina HiSeq4000 lanes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclei were then resuspended in transposase reaction mix for 30 min at 37 °C (Illumina, Fc-121-1030). The samples were purified using Qiagen MiniElute kit (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... we used 0.2ng of cDNA per cell and one-eighth of the Illumina NexteraXT (Illumina FC-131-1096) reaction volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... nuclei were extracted from cells and treated with transposition mixture containing Nextera Tn5 Transposase (Illumina, FC-121-1030) for 30 minutes at 37°C with 1000 RPM mixing ...
-
bioRxiv - Cancer Biology 2022Quote: ... before being processed for Illumina sequencing via the Nextera XT DNA Library Preparation kit (Illumina; FC-131-1096). Sequencing was performed on an Illumina platform.
-
bioRxiv - Genomics 2022Quote: ... Nuclei pellets were resuspended in 50 μL transposition reaction containing 2.5 μL Tn5 transposase (FC-121-1030; Illumina). The reaction was incubated in a 37°C heat block for 45 min ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Neuroscience 2022Quote: Sequencing libraries were prepared using the Illumina Nextera XT DNA Sample Preparation kit (Illumina, Ref. FC-131-1096) and the combination of 384 Combinatorial Dual Indexes (Illumina-Set A to D ...
-
bioRxiv - Microbiology 2023Quote: Adapter ligation and barcoding were performed using the Nextera XT Index Kit (#FC-131-1002, Illumina®, UK). PCR conditions involved 3 min of denaturation at 98°C ...
-
bioRxiv - Synthetic Biology 2023Quote: The sequencing libraries were mixed with 20–30% of PhiX spike-in DNA control (Illumina #FC-110-3001) for better cluster generation on the flow cell and sequenced by Illumina MiSeq (MiSeq v3 150-cycles kit #MS-102-3001 or 300-cycles kit #MS-102-3003) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pooled amplicons were then sequenced on an Illumina MiniSeq system (300 cycles, Illumina sequencing kit #FC-420-1004) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: Next-generation sequencing libraries were prepared using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina). Following fluorometric quantification ...