Labshake search
Citations for Illumina :
751 - 800 of 1668 citations for 5 4 Iodophenoxy methyl furan 2 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... A total of 4 µg of RNA per sample was subjected to rRNA depletion using the RiboZero Plant Leaf kit (Illumina, MRZPL1224) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
bioRxiv - Immunology 2024Quote: ... One library consisting of a total of 4 samples were pooled and sequenced on the NextSeq 2000 (Illumina, San Diego, CA) using a P3 100 cycle kit (Illumina) ...
-
bioRxiv - Genetics 2024Quote: ... and feature barcoding libraries were pooled at a 4:1:1 ratio and treated with Illumina Free Adapter Blocking Reagent (Illumina, #20024144). Sequencing of pooled libraries was carried out on a NextSeq 2000 sequencer (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Microbiology 2024Quote: ... to which 5 µl of P7 and P7 of Nextera XT Index Kit v2 index primers (Illumina, Cambridge, UK) and 7 µl of the previous tagmentation reaction were added ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ul of Tn5 tagmentation mix (1X Tagment DNA buffer, Illumina; ATM mix, Illumina and cDNA library 1 ng) was prepared for cDNA fragmentation ...
-
bioRxiv - Genomics 2024Quote: ... libraries were amplified for 5 cycles with 0.5 μl i5 and i7 Nextera adapters (10 μM) following the instructions provided by Illumina. Finally ...
-
bioRxiv - Genetics 2024Quote: ... 5 µg of total RNA for each sample was then processed using the Tru-Seq stranded mRNA kit (Illumina) following manufacturer instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries for 5 biological replicates were pooled and 100bp paired end reads were generated on a NovaSeq 6000 (Illumina). Reads were trimmed and quality filtered using TrimGalore with a minimum phred score of 20 then aligned to hg19 using STAR 64 with quantMode to obtain read counts ...
-
bioRxiv - Plant Biology 2020Quote: 126 cDNA libraries were prepared using the Illumina TruSeq RNA Sample Preparation Kit v.2 (Illumina, USA) from isolated RNA ...
-
bioRxiv - Plant Biology 2020Quote: ... where they were sequenced on a MiSeq instrument in paired-end 2 × 300 bp mode (Illumina, USA). The raw sequencing data was deposited at the European Nucleotide Archive (http://www.ebi.ac.uk/ena) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and were sequenced on the Illumina NovaSeq (>70 million 2×150 bp sequences) (Illumina, San Diego, CA).
-
bioRxiv - Developmental Biology 2021Quote: ... Paired-end 2 x 75 bp NSQ 500/550 Hi Output KT v2.5 −75 CYS (Illumina, 20024906) was performed for RNA-seq libraries on an Illumina Nextseq 500 instrument ...
-
bioRxiv - Cell Biology 2020Quote: ... and samples were subsequently sequenced (paired end, 2×250bp) on a HiSeq1500 machine (Illumina, San Diego, CA). Bio-informatic analysis of the data was done with an in-house developed pipeline based on Picard Tools (Broad Institute ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were each sequenced on one full 2 × 150 bp PE (paired end) HiSeq 4000 lane (Illumina).
-
bioRxiv - Genomics 2021Quote: ... The pooled libraries were sequenced in an Illumina HiSeq4000 instrument (2 x 150 bp PE reads) (Illumina). A PhiX control library was applied to the sequencing run as a base balanced sequence for the calibration of the instrument so that each base type is captured during the entire run ...
-
bioRxiv - Molecular Biology 2021Quote: Libraries were sequenced using paired end sequencing (2 × 150 bp) on a NovaSeq high-throughput sequencer (Illumina) at the University of Colorado Genomics Core Resource ...
-
bioRxiv - Molecular Biology 2020Quote: ... beginning at Elution 2 – Fragment – Prime step immediately preceding cDNA synthesis according to the manufacturer instructions (Illumina) with the following modifications ...
-
bioRxiv - Genomics 2020Quote: ... Amplicons were paired-end (2 × 250 nt) sequenced on an Illumina NovaSeq (Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2020Quote: ... using the Illumina MiSeq platform (2×1300 paired-end; MiSeq Reagent Kit v3 supporting 600-cycles, Illumina). The resulting sequence reads were filtered ...
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library.
-
Limited haplotype diversity underlies polygenic trait architecture across 70 years of wheat breedingbioRxiv - Genomics 2020Quote: ... Sequencing with 2×150bp reads was performed at the Earlham Institute on a NovaSeq 6000 instrument (Illumina) with 16 promoter capture libraries on one lane and 16 genic capture libraries on another lane.
-
bioRxiv - Biochemistry 2021Quote: ... and 2 × 76 paired-end sequencing performed using the Illumina NextSeq 500 (Illumina, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... They were sequenced to a targeted depth of 40M 2×100bp reads on a NovaSeq 6000 (Illumina). Differential expression analysis was performed by reading kallisto counts files into R using the R packages tximport (v.1.10.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7.6] and Transposition buffer [2 µl of Illumina adapters-bearing Tn5 transposase (FC-121-1030, Illumina), 0.02% digitonin and 0.2% Tween-20 in PBS] ...
-
bioRxiv - Plant Biology 2021Quote: ... Using 2 x 150 bp paired-end reads generated with the Nextera Truseq libraries (Illumina, CA, USA).
-
bioRxiv - Plant Biology 2021Quote: ... RNAseq libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) and barcoded individually following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... and paired-end (2×150 bp) sequencing was performed on a NovaSeq 6000 sequencer (Illumina Inc., USA) from the Macrogen Inc ...