Labshake search
Citations for Illumina :
701 - 750 of 970 citations for CD28 Human Cynomolgus HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... Sequencing library DNA preparation was performed using the Tn5 tagmentation-based method with 1/4 volumes of the Nextera XT DNA Library Preparation Kit (Cat# FC-131-1096, −2001, −2002, −2003, and −2004, Illumina, San Diego, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... 1.5 pM of pool (combined with 40% spiked-in) was loaded onto a NextSeq 500 Mid-Output Kit (150 cycles) cartridge (catalog #FC-102-1001; Illumina, San Diego, CA) for high throughput sequencing on a NextSeq 500 instrument (Illumina) ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting full-length enriched cDNA library was processed into the sequencing library using the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). The quality of the libraries was inspected by size and concentration by agarose gel electrophoresis before pooling the libraries ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA libraries with an average size of 1.5-2 kb were tagmented and indexed during a second PCR amplification step with the Illumina Nextera XT DNA preparation kit (Illumina, FC-131-1024). Tagmentation was performed according to the manufacturer’s protocol with an input of 500 pg cDNA and amplicon tagment mix for 5 min at 55 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The sequencing amplicon pools were diluted to 0.2 ng/µl and tagmented with Nextera XT library prep kit (Illumina, Cat#FC-131-1024). Nextera libraries were dual-barcoded and sequenced on an Illumina NextSeq1000 instrument ...
-
bioRxiv - Genomics 2019Quote: EHVols were sequenced with the Illumina Miseq and Nextseq platforms using the Trusight Cardio Sequencing Kit (Illumina, Catalog No. FC-141-1010 (MiSeq) and FC-141-1011 (NextSeq ...
-
bioRxiv - Developmental Biology 2019Quote: ... Approximately 250pg of cDNA was used for preparation of dual-indexed libraries using the Nextera XT DNA Library Preparation Kit (Illumina # FC-131-1002) following the manufacturer’s procedures.
-
bioRxiv - Cancer Biology 2020Quote: ... and centrifuged at 500 g at 4° C to isolate nuclear pellets that were treated in 50 μL reactions with Nextera Tn5 Transposase (Illumina, FC-121-1030) for 30 min at 37° C ...
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended on ice in the transposition reaction mix (2x TD Buffer, 2.5μL Tn5 Transposes and Nuclease Free H2O) (Illumina Cat #FC-121-1030, Nextera) on ice and the transposition reaction was incubated at 37°C for 45 min ...
-
bioRxiv - Neuroscience 2021Quote: 1 uL of diluted cDNA per well was used for library preparation using the Nextera XT DNA Sample Prep Kit (Illumina, #FC-131-1096). Each C1 IFC was pooled into one library ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Immunology 2020Quote: ... University of Edinburgh using the NextSeq 500/550 High-Output v2 (150 cycle) Kit (# FC-404-2002) with a High Out v2.5 Flow Cell on the NextSeq 550 platform (Illumina Inc, #SY-415-1002). 8 libraries were combined in an equimolar pool based on the library quantification results and run across one High-Output Flow Cell ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-indexed and multiplexed samples were run on an Illumina Next Seq 500 sequencer using a NextSeq 500 v2 kit (FC-404-2005; Illumina, Can Diago, CA) for paired-end sequencing.
-
bioRxiv - Immunology 2021Quote: ... Libraries were quantified sing Qubit High-Sensitivity DNA kit and preparation kit and libraries were constructed using Nextera XT DNA tagmentation (Illumina FC-131-1096) using 800 pg of pooled cDNA library as input using index primers with format as in Gierahn et al [46] ...
-
bioRxiv - Immunology 2022Quote: ... and pooled to form an equimolar sequencing library that was denatured and diluted to 1.2 pM with a 20% PhiX v3 control library (Illumina, Cat#FC-110-3001), as described in the Illumina Denature and Dilution protocol (Illumina ...
-
bioRxiv - Microbiology 2022Quote: Sequencing libraries were prepared from 1 ng of each VSG PCR product using the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) following the manufacturer’s protocol except for the final cleanup step ...
-
bioRxiv - Genomics 2022Quote: ... Indexed libraries were generated using Illumina Nextera XT DNA Library preparation Index Kit (Illumina, Cat No. FC-131-1096 and CF-131-1002), which is capable of multiplexing (up to 96 available indexes) ...
-
bioRxiv - Genomics 2022Quote: ... Indexed libraries were generated using Illumina Nextera XT DNA Library preparation Index Kit (Illumina, Cat No. FC- 131-1096 and CF-131-1002). We performed 125 nt paired end sequencing for each library independently on the same chip (one library per lane ...
-
bioRxiv - Genomics 2022Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Microbiology 2022Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired-end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...
-
bioRxiv - Neuroscience 2023Quote: ... Multiplex samples Pool (1.65 pM including PhiX 1%) was loaded in NextSeq 500/550 High Output v2 kit (75 cycles) cartridge (catalog #FC-404-1005; Illumina, San Diego, CA) and loaded on NextSeq 500 System machine (Illumina) ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Molecular Biology 2022Quote: ... before final pooling and subsequent run on a MiniSeq Sequencing System using the Miniseq High Output Kit (75 cycles) (Illumina #FC-420-1001) with a 10% of phiX spike-in.
-
bioRxiv - Biophysics 2023Quote: ... The DNA concentration was measured using the Qubit dsDNA BR assay kit and sequenced using a HiSeq SBS v4 50 cycle kit (Illumina FC-401-4002) and HiSeq SR Cluster Kit v4 (Illumina GD-401-4001 ...
-
bioRxiv - Immunology 2023Quote: ... 100,000 nuclei per sample were isolated using an iodixanol gradient and ATAC-seq was subsequently performed according to the original protocol (Buenrostro et al, 2013) using Nextera DNA Sample preparation kit (Illumina, FC-121-1030). After library amplification ...
-
bioRxiv - Genomics 2023Quote: ... a total of 0.75 ng of DNA was combined with 2.5 µl 1/35th diluted transposome (Illumina; purchased in kit # FC-121-1011), and 1X Tris Buffer (10X Tris Buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... of libraries were pooled and subjected to sequencing of approximately 20 million reads per sample using the Mid Output v2 kit (Illumina, FC-404-2001) on a Illumina NextSeq550 following the manufacturer’s instructions.
-
bioRxiv - Genetics 2023Quote: ... Pooled libraries were diluted and processed for either 75-bp single-end or 35-bp paired-end sequencing on an Illumina NextSeq 500 instrument (ID: NB501524) using the NextSeq 500 High Output v2 kit (75 cycles) (Illumina; FC-404-2005) in accordance with the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... The pelleted nuclei were gently resuspended with 50 µl of transposition reaction containing 25 µL 2X Tagmentation buffer (Illumina Cat FC-121-1030), 5 µL Tn5 transposase (Illumina Cat FC-121-1030 ...
-
bioRxiv - Genomics 2023Quote: ... The filtered nuclei were pelleted at 500 r.c.f for 5 min in a pre-chilled fixed-angle centrifuge and then resuspended in 25 μl of 1.25x Tagment DNA Buffer (Nextera XT Kit, Illumina Inc. FC-131-1024). For cell cultures ...
-
bioRxiv - Genomics 2023Quote: ... about 1.5 ng purified pre-amplified cDNA sample was fragmented in four 20 μl tagmentation mix (10 μl 2x TD buffer, 5 μl Nextera XT (Illumina, FC-131-1096), and 5 μl cDNA sample ...
-
bioRxiv - Genetics 2023Quote: ... Pooled libraries were diluted and processed for 35-bp paired-end sequencing on an Illumina NextSeq 500 instrument (ID: NB501524) using the NextSeq 500 High Output v2 kit (75 cycles) (Illumina; FC-404-2005) in accordance with the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... Each donor library pool was sequenced twice using the Illumina NextSeq500 with NextSeq 500/550 High Output v2 or v2.5 75-cycle kits (Illumina, USA; FC-404-2005). Libraries were sequenced using the following cycle parameters ...
-
bioRxiv - Developmental Biology 2023Quote: ... 600 pg of pre-amplified cDNA were then used as input for Tn5 transposon tagmentation by the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) followed by 12 cycles of library amplification ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA concentration was measured using the Qubit dsDNA BR assay kit and sequenced using a HiSeq SBS v4 50 cycle kit (Illumina FC-401-4002) and HiSeq SR Cluster Kit v4 (Illumina GD-401-4001 ...
-
bioRxiv - Genomics 2023Quote: ... The tagmentation and library preparation was performed with the Nextera DNA Library Preparation Kit with 8 cycles of PCR amplification (Illumina #FC-121-1030).
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated from the resulting cDNA (0.2ng/ul per sample) using the Nextera XT DNA library preparation kit (Illumina, Cat.no. FC-131-1024) as previously described68 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cell pellet was resuspended in Illumina TD buffer and 2.5 µl of Tn5 enzyme was added to the transposition reaction (Illumina, Cat # FC-121-1030). Nuclei were incubated at 37°C for 60 minutes and fragmented DNA was purified using the MinElute kit (Qiagen ...
-
bioRxiv - Systems Biology 2023Quote: ChIP-seq and input libraries were sequenced on the Illumina NextSeq 500 system with a ∼20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Cell Biology 2023Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75Lcycles) (Illumina, #FC-404-2005). The library loading concentration was 2.4 pM ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNA libraries were then fragmented and amplified for sequencing using the Illumina Nextera XT DNA Library Preparation kit (Illumina, FC-131-1096) using custom primers that enabled the specific amplification of only the 3’ ends ...
-
bioRxiv - Immunology 2023Quote: ... Nuclei were resuspended in the Nextera transposition reaction mix (25 μL 2x TD Buffer, 2.5 μL Nextera Tn5 transposase (Illumina Cat #FC-121-1030), and 22.5 μL nuclease free H2O ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were constructed by following a previous protocol that optimizes reagent usage for microbial genomes [85] with the Nextera DNA Library Preparation Kit (Illumina, FC-121-1030) and sequenced on an Illumina HiSeq 2500 (UNH ...
-
bioRxiv - Developmental Biology 2023Quote: ... and transferred to 3.0 μl Tn5 transposome mixture (0.25 μl Tn5 transposome, 2.5 μl tagmentation buffer, Illumina, FC-121-1030; 0.25 μl H2O). The samples were incubated in 37 °C water bath for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cDNA was then amplified using 10 cycles and subsequently (0.33 ng) used to construct a pool of uniquely indexed samples using the Nextera XT kit (Illumina, Cat# FC-131-1096). Finally ...
-
bioRxiv - Genomics 2023Quote: ... Isolated nuclei were lysed and transposed for 30 minutes at 37°C using the prokaryotic Tn5 transposase system (Nextera DNA library kit, Illumina, FC-121–1030). Transposed DNA was then purified on Diapure columns (Diagenode Cat# C03040001) ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina, cat. no. 20028317; 0.5% of the PhiX control library, Illumina, cat. no. FC-110-3001) and the standard clustering procedure.
-
bioRxiv - Immunology 2024Quote: ... paired-end libraries were constructed from 1 µg of the initial genomic material using the TruSeq DNA v2 Sample Prep Kit (Illumina, #FC-121-2001) as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Approximately 1 ng of cDNA per cell was transformed into a single-cell library using the Nextera XT DNA Library prep kit (Illumina FC-131-1096) and following the manufacturer’s instructions with slight modifications ...