Labshake search
Citations for Illumina :
651 - 700 of 1012 citations for CD28 Human Cynomolgus HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Libraries were sequenced using a 150 bp paired-end NextSeq High Output V2 reagent kit (Illumina, FC-404-2004, San Diego, CA). Illumina short reads were assembled into contigs in two steps ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2.5 µL Tn5 transposase and 22.5 µL nuclease-free H2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Genomics 2020Quote: ... 2000 and underwent a 50 cycle single read sequence run with TruSeq SBS Kit v3-HS reagents (Illumina, Cat. FC-401-3002). The raw sequence reads were aligned to the reference genome using STAR (version 2.7.3a) ...
-
bioRxiv - Cancer Biology 2021Quote: ... A total of 140 pg of the amplified cDNA was fragmented using Nextera XT DNA sample preparation kit (Illumina FC-131-1096) and amplified with Nextera XT indexes (Illumina FC-131-1001) ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Cancer Biology 2020Quote: ... Drop-seq denatured libraries were loaded at 1.3pM final concentration and were spiked in with 10% of 1.8pM PhiX Control v3 (Illumina Cat# FC-110-3001). Sequencing specifications were as follows ...
-
bioRxiv - Genomics 2019Quote: ... Tagmentation of cDNA was performed and sequencing libraries were prepared using the Nextera XT DNA sample preparation kit (Illumina, FC-131-1096) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Second, the pellet was resuspended in the transposase reaction mix (25 μl 2× TD buffer, 2.5 μl transposase (Illumina, FC-121-1030) and 22.5 μl nuclease-free water) ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl each of P7 and P5 Nextera XT Index Kit v2 index primers (Illumina Catalogue numbers FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:15 and subsequently tagmented and amplified for 12 cycles using the Nextera XT DNA Library Preparation Kit (Illumina FC-131). Individual libraries were QC’d by Qubit and Agilent Bioanalyzer ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% spike-in of the ϕX174 control library (Illumina #FC-110-3002) and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL each of P7 and P5 of Nextera XT Index Kit v2 index primers (catalogue No. FC-131-2001 to 2004; Illumina, Cambridge, UK) were also added to each well ...
-
bioRxiv - Immunology 2020Quote: ... The cell pellets were resuspended in 50 μl transposition mix (25 μl 2X TD buffer, 2.5 μl transposase (Illumina, FC-121-1030), 16.5 μl PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were diluted to a final concentration of 2.8 pM in HT1 buffer (supplemented with the kit) and loaded on 75-cycle high-output flow cells (Illumina, FC-404-2005) and sequenced on a NextSeq 550 (Illumina) ...
-
bioRxiv - Genetics 2019Quote: ... 300 pg of each sample was enzymatically fragmented and indexed using a Nextera XT DNA Library Preparation Kit (Illumina FC-131-1024), and Index Kit (Illumina FC-131-1001) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cell pellet was resuspended in 50 μl transposition mix (25 μl 2X TD buffer, 2.5 μl transposase (Illumina, FC-121-1030), 16.5 μl PBS ...
-
bioRxiv - Genomics 2019Quote: ... as per the manufacturer’s instructions and sequenced on an Illumina NextSeq500 machine with 13 libraries pooled at 1.8 pM using one High Output Kit v2 (Illumina #FC-404-2005) with 75 cycles single-end.
-
bioRxiv - Microbiology 2022Quote: ... Libraries were sequenced using a 150 bp paired-end NextSeq High Output V2 reagent kit (Illumina, FC-404-2004, San Diego, CA). Finally ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 000 nuclei were subjected to Tn5 transposition reaction using 2.5 μl TDE1 from Nextera DNA Library Prep Kit (Illumina, #FC-121-1030). After adding the transposition reaction mix ...
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were then pooled and sequenced with a NextSeq 500/550 Mid Output v2 kit (150 cycles) according to the manufacturer’s recommendation (Illumina, FC-404-2001). Pooled samples were run in triplicate for a minimum sequencing depth of 20 million reads per sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Genomics 2023Quote: HMW DNA from 1.5 x 106 cells was used to generate Illumina libraries with the Nextera XT DNA Library Preparation kit (Illumina FC-131-1024) and Illumina DNA PCR-Free Library Prep ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting cell nuclei were subjected to incubation for 30 min with Tagment DNA TDE1 Enzyme and Buffer (Illumina, #FC-121-1030). This step fragmented the chromatin and inserted sequencing adapters ...
-
bioRxiv - Microbiology 2023Quote: ... The sequencing libraries were prepared using a modified protocol for the Nextera XT DNA library preparation kit (Illumina Inc. FC-131-1024). The genomic DNA was fragmented ...
-
bioRxiv - Genomics 2023Quote: ... Two biological replicates of 7.5 × 104 cells for each condition were then isolated for direct processing with Nextera Tn5 enzyme (Illumina, FC-131-1096). Samples were treated as previously described (77 ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing adaptors were added by tagmentation and amplified for 12 cycles using the Nextera XT DNA Library Preparation Kit (Illumina, # FC-131). Libraries were pooled at a final concentration of 1.35 pM ...
-
bioRxiv - Biochemistry 2023Quote: ... Paired-end sequencing libraries were generated from each dsDNA sample using the Nextera XT DNA Library Preparation Kit (Illumina FC-131-1024) exactly as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were diluted to a concentration of 0.2 ng/µL and sequencing libraries were prepared using the Nextera XT Library Prep protocol (Illumina FC-131-1024). M-RTPCR and library preparation was performed in duplicate for all viral RNA ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was converted into double stranded cDNA using NEBNext mRNA Second Strand Synthesis Module (E6111L) and sequencing libraries were generated by tagmentation using Nextera XT DNA Library Preparation Kit (Illumina FC-131) with 12 cycles of PCR amplification ...
-
bioRxiv - Biochemistry 2022Quote: The sequencing libraries were built by tagmentation using 50 ng of ds cDNA with Illumina Nextera XT Kit (Illumina, #FC-131-1024) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Paired end sequencing was performed on an Illumina NextSeq 500 with a 150-cycle high output kits (Illumina, Cat# FC-404-2002).
-
bioRxiv - Genomics 2023Quote: ... we adapter-ligated libraries by tagmentation using an adaptation of the Nextera Library Prep kit (Illumina, cat. No. FC-121-1030/1031)[25] ...
-
bioRxiv - Genetics 2023Quote: ... 150 pg of cDNA was used to produce sequencing libraries with the Nextera XT DNA Sample Preparation Kit (Illumina, FC-131-1024). Libraries were then sequenced for 50 single read cycles and 30 million reads per sample on Illumina NovaSeq 6000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA-seq libraries were generated from 100pg of amplified cDNA using the NEXTERA XT DNA Library Preparation kit (Illumina, FC-131-1096), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The NGS library was prepared with the Nextera XT DNA Library prep kit following manufacturer’s instructions with changes (Illumina #FC-131-1096). Initially ...
-
bioRxiv - Immunology 2023Quote: ... 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog#: FC-131-1024). Libraries were quantified with Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific catalog# ...
-
bioRxiv - Developmental Biology 2021Quote: ... ATAC-seq libraries for murine endothelial cells were processed as previously described (Buenrostro et al., 2015) and libraries were generated using the Nextera DNA Sample Preparation Kit (Illumina, FC-121-1030). The quality of purified DNA libraries was checked by Agilent High Sensitivity DNA kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... Jude Children’s Research Hospital Hartwell Center with DNA libraries prepared using Nextera XT DNA-Seq library prep kits (Illumina, cat#FC-131-1024) with 96 dual-index bar codes and sequenced on an Illumina MiSeq personal genome sequencer ...
-
bioRxiv - Developmental Biology 2020Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 pM and sequencing configuration as following ...
-
bioRxiv - Developmental Biology 2021Quote: Approximately 50,000 nephron progenitor cells were used to generate each sequencing library for the assay for transposase-accessible chromatin (ATAC-seq) using the Nextera DNA Flex Library Prep Kit (Illumina FC-121-1030) with modifications according to a previously published method (Buenrostro et al. ...
-
bioRxiv - Genomics 2022Quote: ... One ng of the pooled amplicons was used for library construction with the Nextera XT DNA library preparation kit (#FC-131–1096; Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were resuspended in 25 μl of 2X TD Buffer and combined with Tn5 enzyme from the Nextera DNA Sample Preparation Kit (Illumina, FC-121-1030) and water to final volume 50 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were resuspended in 50 μl of the following PCR master mix with indexed primers from the Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011): Phusion HF 2X (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting library was diluted to 10-pM in 600-μL of HT1 hybridization buffer (Illumina Nextera XT kit Cat#FC-131-1024) and 10-μL was loaded onto a 300-cycle MiSeq Nano v2 flow cell (Illumina Cat#MS-102-2002 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA from approximately 15-20 progeny per mutant were pooled and sequencing libraries were prepared with a Nextera kit (Illumina, FC-121-1030). All whole genome sequencing data is available on NCBI SRA (accession #PRJNA526508) ...
-
bioRxiv - Genomics 2020Quote: ... The dissolved DNA was then tagmented using 0.6 μl TD Tagmentation buffer and 0.3 μl ATM Tagmentation enzyme from Nextera DNA Library Prep Kit (Illumina, catalog no. FC-121-1030) for 5min at 55 °C ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Genomics 2019Quote: ... Four libraries were paired-end sequenced (75 nt each) with the NextSeq 500 using the Mid Output v2 kit (150 cycles) (Illumina, #FC-404-2001).
-
bioRxiv - Genomics 2019Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using custom ReadOne primer (IDT) and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 nM ...