Labshake search
Citations for Illumina :
701 - 750 of 1962 citations for 6H Benzo g 1 4 diazonino 7 6 5 cd indol 6 one 10 ethenyl 1 3 4 5 7 8 10 11 12 13 decahydro 4 hydroxymethyl 8 10 13 trimethyl 7 13 bis 1 methylethyl 4S 4R* 7R* 10S* 13S* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end sequencing (300 bp) with a dual 8-bp barcode was performed using MiSeq (Illumina, San Diego, CA, USA). The sequence reads were sorted individually using each barcode.
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing was performed in paired-end mode with an S1 flow cell (28/8/87 cycles) and a NovaSeq 6000 sequencer (Illumina) at the MGX core facility of Montpellier ...
-
bioRxiv - Plant Biology 2023Quote: ... value of 8 was employed for RNA-Seq library construction using the TruSeq Stranded Total RNA Library Prep Plant kit (Illumina). Hisat2 (Kim et al. ...
-
bioRxiv - Genomics 2024Quote: ... since the original data were produced on a different beadchip with respect to the HO and 1240K data (Infinium Omni2.5-8 Illumina beadchip). The results of the first two PCs were visualized in R-4.1.3 (https://www.r-project.org/ ...
-
bioRxiv - Bioengineering 2024Quote: ... with 2 × 151 bp paired-end dual indexed (2 × 8 bp) reads or using the Nextera DNA Flex Library Preparation Kit (20018705; Illumina) on the NovaSeq6000 sequencer (Illumina ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...
-
bioRxiv - Developmental Biology 2022Quote: ... All 6 individual libraries were pooled in equal amount and sequenced with the HiSeq 4000 platoform (Illumina). The RNA-seq data are available under the GEO accession no ...
-
bioRxiv - Genomics 2020Quote: ... We used the Nextera DNA CD indexes (Illumina, San Diego, USA). We cleaned the libraries using 0.9x sample purification beads and eluted in 32μl resuspension buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Plant Biology 2021Quote: ... were randomly pooled (4 samples per pool) and grouped using the TruSeq Paired-End Reads Cluster Kit on the cBot platform (Illumina Inc., San Diego, CA, USA). The cDNA libraries were posteriorly sequenced on the Illumina Genome platform Analyzer IIx with a TruSeq kit with 36 cycles (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... We pooled up to 12 samples (with different barcodes) in one lane of a flow cell for sequencing (Illumina HiSeq 2500) and used a 150 bp paired-end read configuration ...
-
bioRxiv - Genomics 2024Quote: ... Miniaturization involved testing libraries at 1/6th (IDT mini) or 1/8th (Roche mini, Illumina mini) of reaction volume tailoring input DNA to each kit between 24-45 ng total (Table 2) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μtagment DNA enzyme (Nextera, Illumina), l nuclease free water ...
-
bioRxiv - Genetics 2019Quote: ... supplemented with 1 μl Tn5 (Illumina). Samples were then reverse cross-linked using the iDeal® ChIP-seq kit for histones according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 1 μl of transposase (Nextera, Illumina) was added and samples were incubated at 37°C for 10 minutes followed by two washes with low-salt buffer ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Molecular Biology 2020Quote: ... High-quality RNA (RIN > 8) was used in library preparation for with the Illumina TruSeq stranded protocol (Illumina, San Diego, USA). Libraries were rRNA depleted using the Illumina Ribo Zero kit and sequenced as single read 75 base pair read length (SR75 ...
-
bioRxiv - Genetics 2021Quote: ... were prepared from RNA samples with a RIN (RNA integrity number) above 8 using the strand-specific TruSeq™ RNA-seq library (Illumina), and 150 bp paired-end read sequencing over three lanes of the Illumina HiSeq4000 sequencing platform was performed at the Norwegian Sequencing Centre ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina barcodes and adapters were attached to pooled and purified products in a second PCR (8 cycles) with the Nextera XT Index Kit A and D (Illumina Inc.). Libraries were purified with Agencourt AMPure XP kit (Beckman coulter ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Cancer Biology 2020Quote: ... libraries are pooled at 8 samples per lane and sequenced on an Illumina HiSeq 4000 sequencer (Illumina Inc, San Diego, CA) at PE 2×100 cycles ...
-
bioRxiv - Cancer Biology 2019Quote: ... libraries are pooled at 8 samples per lane and sequenced on an Illumina HiSeq 4000 sequencer (Illumina Inc, San Diego, CA) at PE 2×100 cycles ...
-
bioRxiv - Molecular Biology 2020Quote: We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the above elute as template ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples with RNA Integrity Number (RIN) >8 were subjected TruSeq Poly-A mRNA Library Pro Kit protocol 15031047 RevD (Illumina, USA) to generate indexed cDNA libraries ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... value of the samples used for library preparation was ≥8 and cDNA libraries were prepared using IlluminaTruSeq Stranded mRNA Sample Prep kit (Illumina, USA) from 4μg of total RNA according to the manufacturers’ instructions ...
-
bioRxiv - Biophysics 2023Quote: ... We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the elute as template ...
-
bioRxiv - Genomics 2022Quote: ... 500 ng of purified RNA with RNA integrity number (RIN) ≥8 was subsequently used for library preparation with the TruSeq Stranded mRNA library Prep (Illumina, #20020594) and sequenced on the Illumina NextSeq500 system using a paired-end 2×75 bp protocol ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina and UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1) from Lexogen (015.96 and 081.96 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bead-bound DNA was amplified with 6 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). Primary samples T-ALL 2-5 ...
-
bioRxiv - Systems Biology 2020Quote: ... Paired-end sequencing (75 cycles with a 6-cycle index read) was performed with the NextSeq 500 (Illumina) platform ...
-
bioRxiv - Cancer Biology 2021Quote: ... Micorarray transcriptional analysis was performed using the HumanWG-6 v3.0 expression BeadChip sytem (Illumina, San Diego, CA, USA) at the Wistar Genomics facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Immunology 2020Quote: ... cells were lysed in lysis buffer for 1 minute and transposed with Tagment DNA Enzyme 1 (Illumina) for 30 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5’ Illumina adapter (used in the Illumina small RNA kit) and a T7 promoter) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5% v/v TDE1 Tagment DNA Enzyme (Illumina, Cambridge, UK) in nuclease free water (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 μl of NT buffer (Illumina, FC-121-1030) was added to each tube to neutralize the tagmentation reaction ...
-
bioRxiv - Genetics 2023Quote: ... 5 μl Nextera XT V2 Index (Illumina, FC-131-2001) primer N7xx ...
-
bioRxiv - Immunology 2020Quote: ... One microgram of high quality RNA (RIN>8) was used as a template for library generation using the Illumina TruSeq RNA Sample Prep Kit v2 (Illumina; CA, USA) according to the manufacturer’s protocol ...