Labshake search
Citations for Illumina :
501 - 550 of 1962 citations for 6H Benzo g 1 4 diazonino 7 6 5 cd indol 6 one 10 ethenyl 1 3 4 5 7 8 10 11 12 13 decahydro 4 hydroxymethyl 8 10 13 trimethyl 7 13 bis 1 methylethyl 4S 4R* 7R* 10S* 13S* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... High-resolution 4-digit HLA typing was performed with the TruSight HLA v2 Sequencing Panel kit from Illumina according to the manufacturer instruction ...
-
bioRxiv - Microbiology 2022Quote: ... Six samples per condition containing 4 μg of total RNA were used for TruSeq mRNA library preparation (Illumina) after being treated with Globin-Zero Gold rRNA Removal Kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were pooled together and sequenced using 75bp paired-end chemistry across 4 lanes of a Hiseq4000instrument (Illumina) to achieve 10 million reads per sample ...
-
bioRxiv - Microbiology 2021Quote: ... Fragments were then indexed with 10 nucleotide barcode sequences using Nextera XT Index Kit v2 Set D primers (Illumina, San Diego, California, USA). Indexing PCR reactions were run in triplicate with a volume of 25 μL using 12.5 μL NEB Next High-Fidelity Master Mix ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting library was diluted to 10-pM in 600-μL of HT1 hybridization buffer (Illumina Nextera XT kit Cat#FC-131-1024) and 10-μL was loaded onto a 300-cycle MiSeq Nano v2 flow cell (Illumina Cat#MS-102-2002 ...
-
bioRxiv - Microbiology 2020Quote: ... The pool was sequenced on an Illumina MiSeq using the 2 × 250 bp v2 kit with a 10% PhiX control following the manufacturer’s protocol (Illumina, Inc., San Diego, CA) and using custom primers developed from (55) ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 10 ug of total RNA was used to remove ribosomal RNA using an Epicentre Ribo-Zero Gold Kit (Illumina, San Diego, USA). Linear RNA was digested following standard protocols using Epicentre Ribonuclease R (Illumina ...
-
bioRxiv - Genetics 2022Quote: ... The TrueMethyl converted DNA samples were then eluted in 10 μL and then processed through the Illumina Infinium MethylationEPIC BeadChip array (Illumina, San Diego, CA) protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... instrument at a concentration of 300 pM with 10% PhiX using the NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles) (Illumina, San Diego, CA, USA) (paired-end ...
-
bioRxiv - Bioengineering 2023Quote: ... 10x libraries were pooled and charged with 1% PhiX on one SP lane of the NovaSeq 6000 instrument (Illumina) using the NovaSeq 6000 SP Reagent Kit v1.5 Raw sequencing data of the modules viability study were processed with Cellranger80 ...
-
bioRxiv - Genomics 2019Quote: ... and reverse transcribed using 25 pmol RT primer (5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’) for TRU-seq barcodes (RP1 primer, Illumina). A portion of the RT product was removed and used for trial amplifications to determine the optimal number of PCR cycles ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Genetics 2021Quote: ... These 6 cats were sequenced on a HiSeq2500 (Illumina, San Diego, CA) to generate 100bp paired-end reads ...
-
bioRxiv - Neuroscience 2019Quote: ... and sequenced 6 samples per lane on a HiSeq 2000 sequencer (Illumina) giving a depth of 30-35 million reads per sample.
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced at 101×6×0×101 on a HiSeq (Illumina) to a minimum depth of 30 million reads per sample.
-
bioRxiv - Immunology 2021Quote: ... and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96– Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified cDNA libraries were run on 6% Novex TBE gels (Illumina), and fragments running between 110-160 bp markers were gel-extracted for subsequent purification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... “alata” [6] from NCBI Sequence Read Archive (seven 101bp paired-end Illumina libraries ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... with Nextera DNA CD Indexes (Illumina #20015882), according to the following program ...
-
bioRxiv - Molecular Biology 2022Quote: ... or purified chromosomes (2 x 106 pelleted at 10,000g for 10min at 4°C) were resuspended in 50 μl transposase mixture (25 μl Illumina TD buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 nM of this pool were loaded on a high output flowcell and sequenced on a NextSeq500 platform (Illumina) with 2×75nt paired-end chemistry.
-
bioRxiv - Systems Biology 2019Quote: ... We sequenced to a depth of at least 500,000 reads per RNA sequencing library (with a typical depth of around 4 million reads) on a NextSeq500 (Illumina). While we targeted 48 clones and 48 controls for each cell line ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled into a 4 nM solution and sequenced on the Illumina MiSeq platform (Illumina; San Diego; CA) with a target sequencing yield of 500MB-1GB per virome.
-
bioRxiv - Neuroscience 2023Quote: ... 4 saline) were pooled at equimolar concentrations and run with 75 bp paired-end reads on the MiSeq (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... The sample was loaded at a concentration of 10 pM and sequenced using 2×250 paired-end strategy on the Miseq (Illumina San Diego, CA, USA) platform for 251 cycles.
-
bioRxiv - Microbiology 2019Quote: ... Resulting data were visualized along with the raw read data using IGV [82] and low abundance isoforms (supported by less than 500 junctional reads or 10 full-length reads from Illumina or nanopore data, respectively) removed prior to producing the final annotation.
-
bioRxiv - Molecular Biology 2022Quote: ... a final dilution to 4nM was performed and 13 pM of the final denaturated library was loaded onto the Illumina MiSeq® with 10% PhiX using 2 × 300 bp v3 chemistry (Illumina Inc., CA, USA).
-
bioRxiv - Microbiology 2019Quote: ... PCR mixtures for amplification contained (per 25 µl reaction): 0.5 µl of each primer (515F and 806R with Illumina tags; 10 µM stock concentration), 12.5 µl of 2x KAPA HiFi Hotstart Readymix (Kapa Biosystems ...
-
bioRxiv - Developmental Biology 2021Quote: ... 100-500 ng of total RNA with RIN values of 9.5-10 underwent polyA selection and TruSeq library preparation according to instructions provided by Illumina (TruSeq Stranded mRNA LT Kit), with 8 cycles of PCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The libraries for Illumina sequencing were constructed according to standard protocols using the Illumina DNA prep kit and IDT 10 bp UDI indices (Illumina, San Diego, CA, USA) by the sequencing facility at SEQCENTER (PA ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... 58°C on two Illumina MouseRef-8 v2.0 Expression BeadChips (Illumina, San Diego, CA, USA). Post-hybridization data read-out ...
-
bioRxiv - Neuroscience 2022Quote: ... Genotyping array analysis was performed by Psomagen with an Infinium Omni 2.5-8 kit (Illumina). To detect SVA ...
-
bioRxiv - Neuroscience 2019Quote: ... 750 ng of the labeled cRNA was hybridized to MouseRef-8 v2 expression beadchips (Illumina) for 16 h before washing and analyzing according to the manufacturer’s directions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Prepared libraries for all 8 samples were pooled and sequenced on a NovaSeq 6000 (Illumina) using 2×96 paired end reads to capture sample index ...
-
bioRxiv - Immunology 2020Quote: ... We genotyped patients using the Illumina OmniExpressExome-8 Bead Chip (Illumina, San Diego, CA, USA).
-
bioRxiv - Genetics 2020Quote: ... The samples were sequenced on a total of 8 lanes using a HiSeq3000 instrument (Illumina) with a single end flowcell for 75 cycles ...
-
bioRxiv - Genomics 2022Quote: ... then single-end sequenced (1 x 100 bp) on one lane using TrueSeq PE150 kit (Illumina, Inc., San Diego, CA) on an Illumina HiSeq 2000 instrument ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Neuroscience 2021Quote: Total mRNA samples were used on MouseWG-6 v2.0 Expression BeadChips by Illumina. Differential expression was analyzed using direct hybridization analysis with quantile normalization ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 6 pM with 15% PhiX control DNA v3 (#FC-110-3001, Illumina) and sequenced on a MiSeq System (Illumina).