Labshake search
Citations for Illumina :
701 - 750 of 1646 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... was applied with S2 flow cells and the 2 x 150 bp paired-end kit (Illumina) according to company protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... and sequencing of 2 × 100 bp paired-end reads using the NovaSeq 6000 (Illumina, United States). Obtained raw reads were mapped to strain the V35 genome using Kallist 0.43.1 with the default setting (Bray et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired end sequencing (2 x 150bp) was carried out on an Illumina Nextseq or Novaseq (Illumina).
-
bioRxiv - Systems Biology 2023Quote: They performed 2 × 50 bp paired-end sequencing on the NextSeq 2000 platform (Illumina Inc, #20038897) using NextSeq 1000/2000 P2 Reagents (100 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... All libraries were pooled and sequenced on a NextSeq 2K P1 2×150-bp run (Illumina) with 20% PhiX target spiked in to account for the low diversity of Tn-seq libraries ...
-
bioRxiv - Genomics 2023Quote: ... RNA-seq (2 × 100 nt paired-end reads) was performed using a HiSeq 3000 instrument (Illumina), yielding an average of 38 million reads/sample.
-
bioRxiv - Microbiology 2023Quote: ... 2×125 bp paired-end library preparation and WGS analysis on a HiSeq 2500 platform (Illumina) was performed by BaseClear (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing was performed in a 2×75 bp paired-end configuration using a NovaSeq platform (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing was performed with the NovaSeq sequencing system using the 2 x 150 bp protocol (Illumina).
-
bioRxiv - Biochemistry 2024Quote: ... Indexes were added by PCR (Table 2) using the Nextera IDT UD Set D (Illumina 20027213) for multiplex sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA libraries were prepared with Illumina TruSeq RNA Sample Preparation Kit v.2 (Illumina, United States) from the extracted RNA ...
-
bioRxiv - Systems Biology 2024Quote: ... and 40 million 2×100 bp paired-end reads were generated per sample using RTA (Illumina) for base calling ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The paired-end sequencing (150 bp × 2) was performed using the Novaseq6000 next-generation sequencer (Illumina). The rRNAs were removed from the total RNAs using the Ribo-Zero Plus rRNA Depletion Kit (Illumina) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were run on a NovaSeq6000 in 150 bp x 2 paired-end mode (Illumina, Japan) at the OIST Sequencing Center ...
-
bioRxiv - Microbiology 2024Quote: ... Shotgun metagenome sequencing was performed on an Illumina NovaSeq 6000 sequencer (2 × 150 bp) (Illumina, USA).
-
bioRxiv - Immunology 2024Quote: ... Next-generation sequencing libraries were prepared with the TruSeq RNA Library Prep kit v.2 (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... in a case of scRNAseq and 2×151 bp on NovaSeq 6000 (Illumina, San Diego, USA) in a case of RNAseq.
-
bioRxiv - Plant Biology 2024Quote: The second PCR and the amplicon sequencing (Illumina V3 kit: 2 × 300 bp paired-end reads) were performed by the Genome Transcriptome Facility of Bordeaux according to standard protocols.
-
bioRxiv - Genomics 2024Quote: ... pair-end sequencing (2*150) of each sample was performed on an Illumina platform (Illumina, USA).
-
bioRxiv - Genomics 2022Quote: ... The libraries prepared were sequenced using the FLO-MIN106 (R9.4) flowcells on PromethION 24 (P24) Nanopore platform and following the paired-end sequencing workflow of Illumina HiSeq2000 platform (Illumina, USA) (Supplementary Method).
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were pelleted (500xg, 10 min, 4 °C) and tagmented with the Nextera DNA Library Prep Kit (Illumina, FC-121-1030) for 1 h at 37 °C ...
-
bioRxiv - Zoology 2020Quote: ... or 70 bp (Exp#4) RNA sequencing (RNAseq) was performed on Illumina HiSeq 2000 platform (Illumina, Inc., San Diego, CA, USA) from libraries construed as has been described in previous report (Zhang et al. ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2023Quote: ... A total of 4 µg of RNA per sample was subjected to rRNA depletion using the RiboZero Plant Leaf kit (Illumina, MRZPL1224) following the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-10 ng of the full-length cDNA was used as input for preparing Nextera XT (Illumina, cat. # FC-131-1024) libraries following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The 16S rRNA gene V3-V4 regions were amplified (4) followed by addition of Illumina sequencing barcoded adaptors (Illumina, CA, USA.). The libraries were normalized and pooled for multiplex sequencing using the Illumina MiSeq v3 600 cycles cartridge (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
bioRxiv - Genomics 2023Quote: ... A total of 4 µg of RNA per sample was subjected to rRNA depletion using the RiboZero Plant Leaf kit (Illumina, MRZPL1224) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA input ranging from 64.4 ng – 1000 ng was used to initiate the Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Illumina 20040525) library preparation ...
-
bioRxiv - Immunology 2024Quote: ... One library consisting of a total of 4 samples were pooled and sequenced on the NextSeq 2000 (Illumina, San Diego, CA) using a P3 100 cycle kit (Illumina) ...
-
bioRxiv - Genetics 2024Quote: ... and feature barcoding libraries were pooled at a 4:1:1 ratio and treated with Illumina Free Adapter Blocking Reagent (Illumina, #20024144). Sequencing of pooled libraries was carried out on a NextSeq 2000 sequencer (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...