Labshake search
Citations for Illumina :
601 - 650 of 1473 citations for LIR 1 LILRB1 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Neuroscience 2022Quote: ... Amplified cDNA (0.125-0.375 ng) was used for generating sequencing libraries with the Illumina Nextera XT DNA kit (Illumina, FC-131-1096). All libraries were sequenced as paired-end 75 using the Illumina HiSeq4000 system.
-
bioRxiv - Synthetic Biology 2019Quote: ... The RNAseq data was generated on an Illumina NextSeq500 75 SE high-output flow-cell (Illumina, cat no. FC-404-2005). The run yielded approximately 550 million reads ...
-
bioRxiv - Evolutionary Biology 2019Quote: We assessed input gDNA quantity using Qubit and normalised the samples to 20ng/ul as described in TruSeq®DNA PCR-Free Library Prep Reference Guide (#FC-121-3001, Illumina) prior fragmentation to 350bp with Covaris S2 ...
-
bioRxiv - Molecular Biology 2020Quote: We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the above elute as template ...
-
bioRxiv - Physiology 2020Quote: ... Samples were sequenced Single-reads 76 bases using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005), and primary data analysis was performed with the Illumina RTA version 2.4.11 and Basecalling Version bcl2fastq-2.20.0.422.
-
bioRxiv - Microbiology 2020Quote: ... aeruginosa (Pae5 and Pae1505) genomic DNA sequencing libraries were prepared using Nextera DNA library prep kit (Illumina, Cat # FC-121-1031) and utilizing the Nextera DNA Sample Preparation Index Kit (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... and DNA libraries for sequencing were constructed using Nextera XT DNA Library Prep kit (FC-131-1024, Illumina, San Diego, CA). The 24 prepared libraries were pooled and submitted to Michigan State University Genomics Facility ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were prepared based on a 20X scaled-down Nextera XT DNA Library Prep Kit (Illumina, Cat. No. FC-131-1024) protocol (35 ...
-
bioRxiv - Genomics 2021Quote: ... and 8.8 µl of paired i7 and i5 Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001) were added to each Tagmentation reaction ...
-
bioRxiv - Neuroscience 2021Quote: ... Tagmentation by Tn5 was performed using reagents from the Nextera DNA Sample Preparation Kit (FC-121-1030, Illumina; San Diego, CA) as previously described [5] ...
-
bioRxiv - Genomics 2020Quote: ... and sequenced on an Illumina NextSeq 500 (NextSeq control software v2.0.2/Real Time Analysis v2.4.11) using a 150-cycle NextSeq 500/550 High Output Reagent Kit v2 (Illumina, FC-404-2002) in standalone mode as follows ...
-
bioRxiv - Immunology 2021Quote: ... single reads and 7 bases index read on an Illumina HiSeq2000 instrument using the TruSeq SBS Kit HS-v3 (50-cycle, FC-401-3002, Illumina Inc). RNA seq data in FASTQ form from each sample were first quality assessed using fastQC ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were resuspended in 50 ul of the transposase reaction buffer (Nextera DNA library prep kit (Illumina cat. FC-121- 1030) and 22.5 ul nuclease-free water ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Tagmentation by Tn5 was performed using reagents from the Nextera DNA Sample Preparation Kit (FC-121-1030, Illumina; San Diego, CA) as previously described (Buenrostro et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... multiplex sample pool (1.5pM including PhiX 1.5%) was loaded in NextSeq 500/550 High Output v2 Kit (75 cycles) cartridge (Illumina; FC-404-1005) and loaded on NextSeq 500 System Machine (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-10 ng of the full-length cDNA was used as input for preparing Nextera XT (Illumina, cat. # FC-131-1024) libraries following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 μL Tn5 transposase and 22.5 μL ddH2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 4 nM library pools were diluted and denatured to 1.3 pM and dual index sequenced on an Illumina Miniseq using a Miniseq Mid Output 300 cycle Reagent kit (FC-420-1004, Illumina, USA). High quality Miniseq runs produced > 2.0Gb ...
-
bioRxiv - Plant Biology 2023Quote: ... libraries were prepared from 2 µg of total RNA using the TruSeq RNA Sample Prep Kit (Illumina, Cat # FC- 122-1001) and sequenced on the HiSeq 4000 to produce at least 18 million 50 bp single-end reads.
-
bioRxiv - Biophysics 2023Quote: ... 100-120 μl pooled-denatured 20 pM library and 10-20 μl 20 pM PhiX control library (Illumina, FC-110-3001) to provide a reasonable spot density in general ...
-
bioRxiv - Biophysics 2023Quote: ... We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the elute as template ...
-
bioRxiv - Genomics 2023Quote: ... Samples were then loaded onto the Illumina NextSeq500 Instrument using a Mid-output 300 cycle kit (Illumina Catalogue FC-404-2003) or the MinION flow cell ONT instrument (R9.4.1) ...
-
bioRxiv - Microbiology 2023Quote: The Acinetobacter isolates libraries were prepared with the Nextera XT DNA Library preparation kit from Illumina (Cat. No.: FC-131-1096) and were sequenced with the NextSeq 550 instrument (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... The denatured library with a final loading concentration of 400 pM in a pool was loaded on the S4 FC using Illumina SBS kits (Illumina, 20012866) with the following setting on the NovaSeq 6000 ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Cancer Biology 2024Quote: ... which was eluted and processed as described in the SPLiT-seq protocol using the Nextera XT kit (Illumina #FC-131-1024) to generate the final RNA derived cDNA SPLiT-seq libraries [9] ...
-
bioRxiv - Developmental Biology 2020Quote: ... the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) was used.
-
bioRxiv - Cancer Biology 2021Quote: ... RNAseq-based gene expression and methylation array (Illumina human methylation450K array) data were downloaded from the ICGC data Portal (https://dcc.icgc.org/ ...
-
bioRxiv - Molecular Biology 2020Quote: ... Methylation was analysed using the Infinium Human Methylation EPIC array (Illumina) using standard operating procedures at the UCL Genomics facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... Probe locations on the human genome (hg19 version) defined by Illumina was used for the analysis ...
-
bioRxiv - Genomics 2019Quote: ... with Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). The cDNA libraries from human and mouse samples were sequenced on the Illumina HiSeq 2500 and Illumina NextSeq 500 platforms ...
-
bioRxiv - Cancer Biology 2020Quote: Human RNA sequencing data and DNA sequencing data (Illumina HiSeq RNASeqV2) from the Colorectal Adenocarcinoma dataset from The Cancer Genome Atlas (Nature 2012 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (2022) sequenced 2,504 human genomes to 30x coverage (Illumina NovaSeq 6000). They mapped these data to the human genome assembly GRCh38 and called genotypes using GATK HaplotypeCaller ...
-
bioRxiv - Cancer Biology 2023Quote: Human RNA sequencing data and DNA sequencing data (Illumina HiSeq RNASeqV2) from the Colorectal Adenocarcinoma dataset from the TCGA Nature 2012 and TCGA PanCancer Atlas from The Cancer Genome Atlas were downloaded from cBioPortal for Cancer Genomics (https://www.cbioportal.org/).57–59 Data was log2 transformed and analyzed using the DESeq2 package in R (v3.0).60
-
bioRxiv - Developmental Biology 2020Quote: Libraries were sequenced on an Illumina HiSeq X™ using HiSeq X™ Five Reagent Kit v2(Illumina, Cat# FC-502-2021).
-
bioRxiv - Synthetic Biology 2022Quote: ... Indexes were added to the amplified DNA using i5 and i7 primers from the Nextera XT Index Kit (Illumina # FC-131-1002). Indexed samples were loaded into a MiSeq Reagent Kit v3 600-cycle (Illumina # MS-102-3003 ...
-
bioRxiv - Bioengineering 2020Quote: ... cDNA libraries were single-end sequenced in 76 cycles using a NextSeq 500 Kit v2 (FC-404-2005, Illumina, San-Diego, CA). High-throughput sequencing was performed using NextSeq500 sequencing system (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries were sequenced using a 150 bp paired-end NextSeq High Output V2 reagent kit (Illumina, FC-404-2004, San Diego, CA). Illumina short reads were assembled into contigs in two steps ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2.5 µL Tn5 transposase and 22.5 µL nuclease-free H2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Genomics 2020Quote: ... 2000 and underwent a 50 cycle single read sequence run with TruSeq SBS Kit v3-HS reagents (Illumina, Cat. FC-401-3002). The raw sequence reads were aligned to the reference genome using STAR (version 2.7.3a) ...
-
bioRxiv - Cancer Biology 2021Quote: ... A total of 140 pg of the amplified cDNA was fragmented using Nextera XT DNA sample preparation kit (Illumina FC-131-1096) and amplified with Nextera XT indexes (Illumina FC-131-1001) ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Cancer Biology 2020Quote: ... Drop-seq denatured libraries were loaded at 1.3pM final concentration and were spiked in with 10% of 1.8pM PhiX Control v3 (Illumina Cat# FC-110-3001). Sequencing specifications were as follows ...
-
bioRxiv - Genomics 2019Quote: ... Tagmentation of cDNA was performed and sequencing libraries were prepared using the Nextera XT DNA sample preparation kit (Illumina, FC-131-1096) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Second, the pellet was resuspended in the transposase reaction mix (25 μl 2× TD buffer, 2.5 μl transposase (Illumina, FC-121-1030) and 22.5 μl nuclease-free water) ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl each of P7 and P5 Nextera XT Index Kit v2 index primers (Illumina Catalogue numbers FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL each of P7 and P5 of Nextera XT Index Kit v2 index primers (catalogue No. FC-131-2001 to 2004; Illumina, Cambridge, UK) were also added to each well ...