Labshake search
Citations for Illumina :
501 - 550 of 1473 citations for LIR 1 LILRB1 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: Sequencing libraries were generated using the sequencing kit: TruSeq SBS Kit v5 – GA (36 Cycle) (FC- 104-5001, Illumina). Samples were then sequenced on an Illumina GA-IIx sequencer using paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina, cat. FC-121-1031). Tagmented DNA was then purified using the MinElute PCR purification kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR-free libraries were prepared from 1μg DNA using the TruSeq PCRfree DNA sample preparation kit (cat# FC-121-3001/3002, Illumina) targeting an insert size of 350bp ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 µl of Tagment DNA buffer 1.25 µl of Amplicon Tagment Mix (Nextera XT kit, Illumina FC-131-1096) were added ...
-
bioRxiv - Genomics 2022Quote: ... 600 pg cDNA from each sample plate was used in a modified Nextera XT (Illumina, Cat. FC-131-1024) library preparation but using the P5NEXTPT5 primer and the tagmentation time of 5 mins ...
-
bioRxiv - Genetics 2022Quote: ... Normalised DNA libraries were clustered on Illumina cBot then sequenced using Illumina HiSeq X Ten platform using HiSeq X Ten Reagent Kit v2.5 kits (FC-501-2501, Illumina). Paired end sequencing was performed using the 2×150bp chemistry to achieve an average output of approximately >120 Gb of data per library.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted to 0.2 ng/ul in TE and tagmented (Nextera XT DNA Library Preparation Kit (#FC-131-1096, Illumina). Indexing was performed using the Nextera XT Index Kit (#FC-131-1001 ...
-
bioRxiv - Cell Biology 2022Quote: ... 10μl of the tagmented chromatin was mixed with 2.5μl of Nextera PCR primer cocktail and 7.5μl of Nextera PCR master-mix (Illumina FC-121-1030) in low-binding PCR tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500/550 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Microbiology 2024Quote: ... This PCR product was prepared for sequencing using the Nextera XT DNA Sample Prep Kit (Illumina, FC-131-1096) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Two arrays were sequenced per sequencing run with an Illumina 75 Cycle NextSeq500/550v2 kit (Illumina FC-404–2005) at a final concentration of 2.4 pM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were added with 50mL trans-position reaction mix of Nextera DNA library preparation kit (FC-121-1031, Illumina). DNA was amplified by PCR and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Tagmentation and indexed library amplification were done with Nextera® XT DNA Library Preparation Kit (Illumina, FC-131-1096) and Nextera® XT Index Kit (96 indexes ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15 nM with addition of 15% Phix control v3 (Illumina, FC-11-2003). The Illumina Mi-Seq post-run processing uses the barcoded indices to split all sequences by sample and generate FASTQ files ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then indexed using forward (i7) and reverse (i5) index primers from the Nextera Index Kit (Illumina FC-121-1011). Index ligation and fragment amplification were achieved using the method’s PCR amplification thermal cycling program.
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mono-nucleosomal DNAs were subjected to sequencing using a TruSeq DNA library prep kit (FC-121-2001, Illumina). The final libraries were sequenced using an Illumina HiSeq 2500 platform ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tagmentation of 600pg of cDNA is performed according to Nextera DNA sample preparation manufacturer instructions (Illumina, Inc., FC-131-1096) using a Truseq-P5 hybrid constant oligo (IDT ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Developmental Biology 2019Quote: ... quantification and Nextera library construction were done following the published ChIPmentation protocol (Schmidl et al., 2015) using indexed Illumina adapters (FC-121-1011, Illumina). Illumina adaptors were removed from the ChIP and ChIPmentation reads using Cutadapt (1.6 ...
-
bioRxiv - Systems Biology 2020Quote: cDNA was tagmented and amplified using the Nextera XT DNA Library Preparation Kit (FC-131-1096, Illumina, San Diego, CA). The manufacturer’s protocol was followed with the following modified reagent volumes and primers ...
-
bioRxiv - Immunology 2019Quote: ... and by enzymatic fragmentation of 300 pg of cDNA followed by 12 PCR cycles using the Nextera XT DNA Library Preparation Kit (cat# FC-131-1096, Illumina). Sequencing of the 15 mRNAseq libraries multiplexed together was carried out with an Illumina HiSeq2500 on a 2x125 bp paired-end run.
-
bioRxiv - Genomics 2019Quote: ... Each sample library was uniquely barcoded and quantified by PCR using a PhiX Control v3 (Illumina, Cat #FC-110-3001) standard curve ...
-
bioRxiv - Genetics 2020Quote: ... MS-103-2003) at a concentration of 15nM with the addition of 15% Phix Control v3 (Illumina, FC-11-2003) previously described by Shaukat et al ...
-
bioRxiv - Genomics 2020Quote: ... was performed on the instrument using HiSeq Rapid SBS Kit v2 (FC-402-4021) and HiSeq Rapid PE Cluster Kit v2 (PE-402-4002) (Illumina). Image analysis was performed using the HiSeq Control Software version 2.2.58 ...
-
bioRxiv - Genetics 2020Quote: ... The cell pellet was resuspended with 50 μl transposition mix containing 25 μl 2X TD buffer (Illumina FC-121-1030), 3.5 μl Tn5 transposase (Illumina FC-121-1030) ...
-
bioRxiv - Cell Biology 2021Quote: ... was performed by incubating beads with tagmentation buffer (12.5 µl 2 x TD buffer, 11.5 µl nuclease free water, 1µl Tn5 enzyme (Illumina #FC-131-1024)) at 37°C for 10min ...
-
bioRxiv - Genomics 2021Quote: ... The nuclei-enriched pellet was immediately used for transposition reaction using Nextera DNA Library Prep Kit (Illumina, FC-121-1030). The transposition reaction was incubated at 370C for 30 min and followed immediately by purification using QIAGEN MinElute Kit (Qiagen ...
-
bioRxiv - Neuroscience 2019Quote: ... NGS libraries were prepared using 150 pg of cDNA input and the Nextera XT DNA Library Preparation Kit (catalog FC-131-1024, Illumina) with 11 cycles of PCR ...
-
bioRxiv - Plant Biology 2020Quote: ... Nuclei pellets were collected as described previously by centrifugation at 1,000 × g and tagmented with Nextera DNA Library Prep Kit (Illumina, catalog number: FC-121-1030, now discontinued; replacement can be found as Illumina Tagment DNA TDE1 Enzyme and Buffer Kits ...
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Genomics 2022Quote: ... A paired-end library was prepared with the TruSeq DNA PCR-Free LT Sample Preparation Kit (Illumina, #FC-121-3001) from 1 µg of the genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... MS-103-2003) at a concentration of 15nM with the addition of 15% Phix Control v3 (Illumina, FC-11-2003) described by Chaudhry et al ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Neuroscience 2021Quote: ... ~600 pg of purified cDNA was used to produce a RNA-seq library using Nextera XT DNA Library Preparation kit (FC-131-1024, Illumina), following the manufacturer instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... tagmentation was carried out on double-stranded cDNA using the Nextera XT Library Sample Preparation kit (Illumina, FC-131-1096). Each well was mixed with 0.8 µl Nextera tagmentation DNA buffer (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100ng of full-lentgth cDNAs are used as input to the Nextera DNA Sample Prep kit (ref FC-121-1030, Illumina) which enriches for 3′ends of cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The sequencing library was prepared using the Illumina TruSeq RNA Sample Prep Kit (FC-122-1001; Illumina, San Diego, CA) with 1 ug of total RNA ...
-
bioRxiv - Cancer Biology 2022Quote: Sequencing libraries were constructed from the cDNA using the Illumina Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). The cDNA library was sequenced on the NovaSeq 6000 instrument using 150-bp paired-end reads.
-
bioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were sequenced for 75 cycles in single-end mode on NextSeq 500 platform (Illumina, FC-404-2005).
-
bioRxiv - Cell Biology 2019Quote: Purified cDNA (75 ng) was used as input to the Nextera XT DNA library preparation kit (Illumina, FC-131- 1096), following the manufacturers protocol with the modification of using 1:5 of reagent volumes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were pooled and tagmentation performed using the Illumina Nextera XT DNA sample preparation kit (Illumina Cat #FC-131-1024), libraries pooled and sequenced on a HiSeq 2000.
-
bioRxiv - Genetics 2019Quote: ... Samples were sequenced using 2×75bp paired-end with the NextSeq 500/550 Mid Output v2 kit (150 cycles; Cat. No. FC-404-2001) on an Illumina NextSeq500 Sequencer (Illumina). Sequencing was performed by the Genome Research Hub at Cardiff University ...
-
bioRxiv - Genomics 2019Quote: Single cell calling card library preparation was performed using the Nextera Mate Pair Sample Prep Kit (Illumina #FC-132-1001) with modifications to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: Calling card libraries from bulk RNA were generated using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1024). One nanogram of PCR product was resuspended in 5 µl ddH2O ...
-
bioRxiv - Genomics 2020Quote: ... and pooled in equal concentrations prior to MiSeq v3 sequencing with 15% phiX control spike-in (Illumina FC-110-3001).
-
bioRxiv - Genetics 2020Quote: ... Transposition reaction was performed according the manufacturer’s protocol for Nextra Tn5 transpoase Nextra kit (Illumina, Cat. No.: FC-121-1030). Transposed DNA fragments were purified by Qiagen MiniElute PCR purification kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and mate-pair libraries of 3 kb and 6 kb insert sizes were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Genomics 2021Quote: ... and each sample was uniquely indexed using Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001). Indexed libraries were purified with Omega Mag-Bind Total Pure NGS Beads ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and mate-pair libraries of 3 kb insert size were prepared using the Nextera Mate Pair Sample Preparation Kit (cat. No. FC-132-1001, Illumina). We then assessed library quality using the HS DNA Kit (Agilent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 30% of Illumina libraries were constructed in-house with the Nextera DNA Library Preparation Kit (Illumina, FC-121-1030) using a protocol based off of previously published protocols51,52 ...