Labshake search
Citations for Illumina :
601 - 650 of 686 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... mRNAs were sequenced in a HiSeq 3000 sequencing system with 2 × 125 bp paired-end sequences (Illumina HiSeq SBS Kit v4) by the Genotoul bioinformatics platform ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Cell Biology 2023Quote: The PCR primers introduce the full-length adaptor sequence required for Illumina sequencing (for details see Illumina small RNA PCR primers). PCR was performed in 12.5 μL using half of the ranhexRT sample as a template [1× KAPA HiFi HotStart ReadyMix (KapaBiosystems KK2602) ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Genomics 2022Quote: ... The tagmented fragments were amplified to add index adaptor sequences using single-use Illumina® DNA/RNA UD Indexes (Cat No: 20027213, Illumina). After Clean-up ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and paired-end sequences of 150 bp x 2 were generated using the Illumina HiSeq3000 System (Illumina, San Diego, CA, USA), targeting a yield of 2 gigabases data per sample ...
-
bioRxiv - Cell Biology 2024Quote: ... The second-strand cDNA was synthesized by adding 100 μM primer (the specific sequence at the 5′ portion corresponds to the primer for sequencing on the Illumina flowcell), 10× Taq DNA Polymerase Buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... from islets was added to 50 μM first-strand RT primer (the sequence at the 5’ portion corresponds to primer P7 on the Illumina flowcell), 10 mM dNTP mix ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Genetics 2021Quote: ... Individual RNA samples for transcriptome analysis were converted into 3′-prime specific MACE libraries (Bojahr et al. 2016) and sequenced with 1x 75 b reads on a HiSeq 2000 machine (Illumina) resulting in 3,1 - 5 million quality filtered reads ...
-
bioRxiv - Microbiology 2019Quote: ... containing 5µL of each index primer (Nextera XT Index kit v2 set A, B and D; Illumina, San Diego, CA), 10ul of purified PCR products (0-20ng/µL ...
-
bioRxiv - Genetics 2021Quote: ... the log R (LRR) intensity measurements and B allele frequency (BAF) for each sample at each probe were exported from Illumina’s Genome Studio software ...
-
bioRxiv - Plant Biology 2020Quote: ... Libraries were characterized using an Agilent Technologies 2100 Bioanalyzer and quantified before sequencing using NextSeq500 and 1 x 75 b read chemistry (Illumina).
-
bioRxiv - Genomics 2019Quote: ... cDNA libraries were constructed using Illumina TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human/Mouse/Rat Set B (Illumina) to deplete ribosomal RNA according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
bioRxiv - Genomics 2019Quote: ... Sequencing libraries of A and B containing 6 bp indexes were prepared using the TruSeq RNA sample prep kit (Illumina) following a modification of the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... To assess genomic integrity of iPS lines we investigated the B-allele frequency and Log R ratio values of each iPS line which were downloaded from Illumina GenomeStudio ...
-
bioRxiv - Genomics 2020Quote: ... we performed adapter ligation using remaining Illumina TruSeq Single DNA Indexes Set A and Set B (Illumina, San Diego, USA), and performed adapter enrichment using the remaining PCR Primer Cocktail from the Illumina TruSeq Nano DNA Library Prep kit ...
-
bioRxiv - Bioengineering 2023Quote: ... A total of 50 ng of DNA was amplified following the 16S Metagenomic Sequencing Library Illumina 15044223 B protocol (ILLUMINA).
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Ligation with Ribo-Zero Plus kit and the IDT ILMN RNA UDI B Lig 96 Idx 96 Spl index kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Reads were trimmed to remove adapter sequences and low-quality regions (Q < 30 and Q < 20 for Illumina and 454 data, respectively) were removed using Cutadapt 1.4.1 (Martin 2011 ...
-
bioRxiv - Genomics 2020Quote: ... 2000 and underwent a 50 cycle single read sequence run with TruSeq SBS Kit v3-HS reagents (Illumina, Cat. FC-401-3002). The raw sequence reads were aligned to the reference genome using STAR (version 2.7.3a) ...
-
bioRxiv - Microbiology 2020Quote: Publicly available data from 158 Achromobacter genomes was downloaded from the NCBI GenBank and Sequence Read Archive (SRA) databases (paired-end Illumina data only) in May 2019 (Table S1) ...
-
bioRxiv - Pathology 2019Quote: ... For whole genome sequence analysis isolates were sequenced (2 × 150 bp paired-end) on a MiSeq system (Illumina, San Diego, CA, USA) as previously described (18) ...
-
bioRxiv - Genomics 2019Quote: ... Sequence libraries were prepared by the Joint Genome Institute following standard the TruSeq Small RNA library preparation protocol (Illumina, San Diego, CA). Samples were sequenced on an Illumina HiSeq 2500 (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... 0.02 µM of specific adapters for the Illumina technology (containing the barcode sequences and complementary to the Illumina ™ primers for sequencing) were connected to the fragments ends generated in the digestion ...
-
bioRxiv - Molecular Biology 2023Quote: Trimmomatic version 0.39 was employed to trim reads after a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides (Bolger et al., Trimmomatic: a flexible trimmer for Illumina sequence data). Reads were aligned versus Ensembl human genome version hg38 (Ensembl release 104 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 35 million pair-end sequences of 100 nucleotides long were produced per sample in a NovaSeq6000 instrument (Illumina, San Diego, CA) at the Genomics Technology Core at the University of Missouri.
-
bioRxiv - Genomics 2023Quote: ... Trimmomatic version 0.39 was employed to trim reads after a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides (Trimmomatic37: a flexible trimmer for Illumina sequence data). Reads were aligned versus Ensembl mouse genome version mm10 (Ensembl release 101 ...
-
bioRxiv - Genomics 2024Quote: ... it enables the observation of all variable sequence elements (spacers, iBARs, and the middle tRNA) with 150-cycle sequencing kits (e.g. Illumina MS-102-3001) and positions spacers and iBARs as early as possible within NGS reads ...
-
bioRxiv - Physiology 2023Quote: Standard Argyrosomus regius gonadotropin subunit amino acidic sequences (alpha common, beta-FSH and beta-LH) were deduced from RNAseq (Illumina and Nanopore) analysis of mRNA extracted from meagre pituitaries ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Extracted DNA was PCR amplified with a forward primer binding to the end of the leader sequence (PCR1 Fwd primer with Illumina adapter overhang) and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang) ...
-
bioRxiv - Cancer Biology 2022Quote: ... but from purified CLL cells (Miltenyi B-CLL Isolation kit) and sequenced on an Illumina HiSeq 4000 (Illumina, Hayward, CA, USA). miRNA data in the form of fastq were quality checked using FastQC ...
-
bioRxiv - Genomics 2021Quote: Custom RNA capture-based libraries were prepared starting from 8.5 μL eluate for biofluid samples and 100 ng RNA for FFPE and MAQCA/B using the TruSeq RNA Exome Library Prep Kit (Illumina, USA). Library preparation happened according to the manufacturer’s protocol with some minor modifications ...
-
bioRxiv - Cell Biology 2020Quote: ... libraries for sequencing were prepared from using the TrueSeq RNA Sample Prep Kit v2-Set B (Illumina, San Diego, CA, US) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... sequence libraries were prepared for each sample using TruSeq Stranded mRNA Library Prep/TruSeq RNA Single Indexes Set A & Set B (Illumina, Inc.). For sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... Fragments were then indexed with 10 nucleotide barcode sequences using Nextera XT Index Kit v2 Set D primers (Illumina, San Diego, California, USA). Indexing PCR reactions were run in triplicate with a volume of 25 μL using 12.5 μL NEB Next High-Fidelity Master Mix ...
-
bioRxiv - Genomics 2020Quote: ... Deep- and shallow-sequence libraries were pooled separately and sequenced on either Illumina HiSeq 2500 or HiSeq 4000 (Table S1, Illumina, San Diego, CA).
-
bioRxiv - Physiology 2019Quote: ... DNA was amplified using fusion primers designed against the surrounding conserved regions that are tailed with sequences to incorporate flow cell adapters and indexing barcodes (Illumina, San Diego, CA). Each sample was PCR amplified with two differently barcoded V4-V5 fusion primers and were advanced for pooling and sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... Sequences were generated at the Berlin Center for Genomics in Biodiversity Research (BeGenDiv) on the Illumina MiSeq platform (Illumina, San Diego, California, USA) in two runs ...
-
bioRxiv - Molecular Biology 2022Quote: ... The forward primers were 5’-CAA GCA GAA GAC GGC ATA CGA GAT XXX XXX GTG ACT GGA GTT CCT TGG CAC CCG AGA ATT CCA-3’ (in which XXX XXX represents Illumina’s indexing hexanucleotide sequences), and the reverse primer was 5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACG TTC AGA GTT CTA CAG TCC GA-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... using poly-T oligos attached to magnetic beads and converted to sequence-ready libraries using the TruSeq stranded mRNA sample prep protocol (cat. #: RS-122-2101, Illumina, San Diego, CA). The final libraries were validated on the bioanalyzer DNA chips ...
-
bioRxiv - Genetics 2022Quote: ... Illumina compatible P5 P7 sequences were added during post capture amplification and libraries were submitted for 2 × 150bp paired-end next generation sequencing (Illumina, San Diego, CA), targeting 15 million clusters per sample ...
-
bioRxiv - Epidemiology 2019Quote: ... The second round of PCR added the Illumina specific sequencing adapter sequences and unique indexes using the Nextera XT Index Kit v2 (Illumina, San Diego, CA) and KAPA HIFI HotStart Ready Mix (Kapa Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... Sequence libraries were prepared by the Joint Genome Institute following the standard TruSeq Stranded mRNA HT library preparation protocol (Illumina, San Diego, CA). Samples were sequenced on an Illumina HiSeq 2500 (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... the amplicon mixture linked to the index sequence was pretreated and loaded into a mini-SEQ analyzer (Illumina MiniSeq system, SY-420-1001) to perform targeted amplicon sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... region was amplified using the primer set (16S-341F/805R, see Table S2 for nucleotide sequences) according to the 16S Metagenomic Sequencing Library Preparation procedure (Illumina; San Diego, CA). The success of PCR amplification was confirmed using agarose electrophoresis (1.5%) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sequences were generated at the Berlin Center for Genomics in Biodiversity Research (BeGenDiv) on the Illumina MiSeq platform (Illumina, San Diego, California, USA) using v2 chemistry with 500 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... A sequencing library for the V3-V4 regions of the 16S rRNA gene was prepared according to a modified version of the instructions provided by the manufacturer (Part # 15044223 Rev. B; Illumina Inc., USA) with some modifications46 and sequenced using the Illumina Miseq System (Illumina Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared from 600ng of total RNA using the TruSeq® Stranded mRNA Library Prep kit and the TruSeq® RNA Single Indexes kits A and B from Illumina. The library quality and quantity were checked using an Agilent 2100 Bioanalyzer and a Qubit dsDNA HS Assay Kit ...