Labshake search
Citations for Illumina :
501 - 550 of 686 citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... The sequence libraries were constructed with a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: A short-read sequence library of ‘Takanotsume’ was prepared using the TruSeq DNA PCR-Free Sample Preparation Kit (Illumina) and sequenced on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... a draft genome for the Olympia oyster was developed using a combination of short-read sequence data (Illumina HiSeq4000) combined with long-read sequence data (PacBio RSII ...
-
bioRxiv - Plant Biology 2022Quote: ... and purified RNA was used to make sequence libraries using True-Seq RNA sample preparation kit from Illumina (Agilent). Sequencing was carried out using HiSeq 2500 standard mode ...
-
bioRxiv - Microbiology 2023Quote: ... 150 bp paired read sequences were generated on the Nextseq 500 (high output) sequencer according to manufacturer’s instructions (Illumina). The multiplexing level was 10 samples per lane ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and DNA arrays) and high-throughput sequencing platforms (22.2% of sequences by 454 amplicon pyrosequencing and Illumina Miseq platforms). For Sanger sequencing and DNA arrays ...
-
bioRxiv - Genomics 2022Quote: A complete genome sequence was generated combining SMRT long-read sequencing (Pacific Biosciences) and Illumina short-read sequencing (Illumina) as described in detail previously (Steglich et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting construct contained a short single stranded sequence gap which was repaired enzymatically according to manufacturer’s protocol (Illumina).The repaired DNA was purified and smaller DNA fragments (< 1500 bp ...
-
bioRxiv - Bioengineering 2023Quote: ... the amplicons were subjected to MiSeq for amplicon sequence analysis by using the MiSeq Reagent Kit v2 (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Only target amplicon sequences under 350 bp size were chosen (length which is adapted for Illumina PE-250 sequencing) and subjected to alignment against the NCBI database using the Basic Local Alignment Search Tool (BLAST) ...
-
bioRxiv - Cell Biology 2023Quote: ... Paired end 38 bp sequences were generated from samples on a NextSeq 500/550 (Illumina, San Diego, CA, USA) with an average of 125 million of reads per sample.
-
bioRxiv - Genomics 2024Quote: Whole metagenome sequence libraries were prepared using an Illumina Nextera DNA Flex Library Prep kit (Illumina, San Diego, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... One hundred nucleotides of sequence were determined from both ends of each cDNA fragment using the Novaseq platform (Illumina). Sequencing reads were aligned to the reference genomes (C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplicons were calculated for their nano-molarity and diluted to 4 nM (see Illumina 470-2016-007-B) for HTS run on MiSeq sequencer using the Illumina MiSeq Reagent Kit Version 3 (600bp pair-ended) ...
-
bioRxiv - Genomics 2020Quote: ... Log R Ratio and B Allele Frequency were extracted using Genome Studio 2.0 (Illumina, San Diego, California, USA). Data available upon request.
-
bioRxiv - Immunology 2021Quote: ... Paired end reads of 150nt were generated for each B-cell enriched library using the MiSeq sequencer (Illumina). The 5’ gene expression libraries were sequenced following 10X Genomics read length guidelines on the NovaSeq6000 sequencer (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... which were further processed using the 16S Metagenomic Sequencing Library Preparation Protocol (Part No. 15044223 Rev. B – Illumina). Amplifications were carried out using a Verity Thermocycler (Applied Biosystem ...
-
bioRxiv - Immunology 2024Quote: ... The PCR products were then tagged using the Nextera XT Index Kit v2 Sets A to B (Illumina), with the amplicon concentrations normalized to 200 ng/µl via the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Immunology 2021Quote: ... Raw sequence data were obtained in Bcl-files and converted into fastq text format using the bcl2fastq program from Illumina. Validation of RNAseq was performed using qRT-PCR as described below.
-
bioRxiv - Genomics 2020Quote: ... Primary sequence data (paired-end, 91 bp reads) was generated using the Illumina HiSeq 2000 (Illumina, Inc., San Diego, CA). We used the Trinity software (Grabherr et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Sequence-ready libraries were prepared using the Illumina TruSeq Stranded Total RNA kit with Ribo-Zero Gold rRNA depletion (Illumina). Quality assessment and quantification of RNA preparations and libraries were carried out using an Agilent 4200 TapeStation and Qubit 3 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... This was performed as described by the protocol of Illumina sequence library preparation (kit: NEB - M6630; protocol: E6040; Illumina, USA). We used a Nanopore MinION flowcell (R10 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and equimolar amounts of library were pooled and sequenced paired-end 2x 75 bp in two sequence runs on a NextSeq 500 system (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... and nucleotide sequences were generated using a NextSeq 500 and a NextSeq 500/550 High Output v2 kit (75 cycles) (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... The Genome Reference Consortium build of the reference sequence (GRCh38/hg38) and the GTF files (NCBI) were used and can be acquired from iGenome (Illumina). Hisat2 was run with the following parameters ...
-
bioRxiv - Genomics 2019Quote: ... We then compared the extracted Nanopore barcode sequences and all possible permutation up to a defined edit distance with: (i) The cellBCs identified by Illumina sequencing for the same gene if the Nanopore read matches a known gene in the Illumina dataset ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using the Sequence by Synthesis technique (providing 2×125 bp reads, respectively) with base calling achieved by the RTA software (Illumina). The Pool-Seq data were deposited in the Sequence Read Archive (SRA ...
-
bioRxiv - Evolutionary Biology 2019Quote: Sequence reads were first parsed into batches with distinct EcoRI-end adapters based on index sequences at the core facility using CASAVA v1.8 (Illumina, Inc.). We processed reads using the pipeline described in DaCosta and Sorenson (2014 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and using alternate primer concentrations with SuperScript IV were subsequently tagged by specific index sequences (Nextera XT DNA Library Preparation Kit, Illumina), pooled and sequenced on a MiSeq instrument ...
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries prepared for each starting RNA amount were tagged by specific index sequences (Nextera XT DNA Library Preparation Kit, Illumina), mixed equimolarly and sequenced on a MiSeq system using a reagent kit v2 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: The forward indexing primer sequence is - AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC and the reverse indexing primer sequence is - CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (where the bolded regions are the p5 and p7 flow cell adapters and [i5] and [i7] refer to the index sequence codes used by Illumina). The qPCR step starts with an initial denaturing step at 95 °C for 5 min followed by 35 cycles of denaturation (20s at 98 °C) ...
-
bioRxiv - Genetics 2021Quote: We merged fastq files from the same library when sequenced on multiple flow cells and trimmed the adapters using sequences provided by Illumina with Cutadapt/1.1562 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAseq reads were aligned against to Ensembl Mouse genome (NCBIM37) reference sequence assembly and transcript annotation that obtained from Illumina iGenomes (https://support.illumina.com/sequencing/sequencing_software/igenome.html ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA sequences were recovered by genomic PCR analysis and deep sequencing using MiSeq for single-end 150-bp read length (Illumina). The primer sequences used for cloning and sequencing are listed in Supplementary Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product mixture was sent to FASMAC to acquire 2 × 250 bp paired-end sequences using the MiSeq platform (Illumina).
-
bioRxiv - Microbiology 2021Quote: Sequence libraries were prepared from the extracted DNA samples using the Nextera DNA Flex Library Prep Kit (Illumina, Cat. # 20018705) following a low volume variation of the standard protocol ...
-
bioRxiv - Microbiology 2020Quote: ... as described previously.15 Sequence libraries for Illumina sequencing were prepared using the Nextera XT kit (Illumina, San Diego, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: 150 nucleotides of the sequence were determined from both ends of each cDNA fragment using the HiSeq 2500 platform (Illumina). An average of 83.79 million read pairs were obtained for each sample (range ...
-
bioRxiv - Microbiology 2020Quote: ... Seventy-five nucleotides of the sequence were determined from both ends of each cDNA fragment using the HiSeq 4000 platform (Illumina). Sequencing reads were aligned to the reference R ...
-
Mitochondrial mutations in Caenorhabditis elegans show signatures of oxidative damage and an AT-biasbioRxiv - Genetics 2021Quote: ... 2) calls duplex consensus sequences (DCSs) based on shared random barcodes (each DCS required a minimum of six raw Illumina reads – at least three from each strand) ...
-
bioRxiv - Microbiology 2022Quote: ... Sequence libraries were prepared from the extracted DNA samples using the Nextera DNA Flex Library Prep Kit (Illumina, Cat. # 20018705) following a low volume variation of the standard protocol.29
-
bioRxiv - Microbiology 2022Quote: ... The viral spike sequences were verified using unbiased NGS sequencing (KAPA HyperPrep library kit with RiboErase, followed by Illumina sequencing). All cells and virus stocks tested negative for mycoplasma using MycoAlert Plus reagents (Lonza) ...
-
bioRxiv - Microbiology 2022Quote: ... The primers Uni530F and Uni907R (Nunoura et al., 2012) containing Illumina TruSeq adapter sequences (Illumina Inc., San Diego, CA, USA) were used for PCR ...
-
bioRxiv - Immunology 2019Quote: ... Final pooled libraries were spiked with 10% PhiX control DNA to increase sequence complexity and sequenced (75bp paired-end) on HiSeq 4000 sequencer (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... Two clones that produce the Y113F substituted Gp8 were propagated twice on strains containing only pCas9-guide for further selection and genomes were sequence verified by Illumina sequencing as described below.
-
bioRxiv - Genomics 2019Quote: Illumina reads were quality trimmed and adapter clipped using Trimmomatic (Bolger et al., 2014) with all available adapter sequences from Illumina. Reads from the 454- and PGM/Ion Torrent-sequencing platform were trimmed with the CLC Genomics Workbench using the trim points of the SFF-files ...
-
bioRxiv - Pathology 2021Quote: ... and the entire sequence of the viral genome was obtained using the next generation sequencer MiSeq (Illumina, San Diego, CA) with a read length of 250 nt ...
-
bioRxiv - Cell Biology 2020Quote: To the cancer hot spot library P5 and P7 sequences were attached by PCR using the custom pBB9 primer and Nextera N701 (Illumina). Library was purified with 0.6x volume fraction AMPure beads ...
-
bioRxiv - Genomics 2020Quote: ... Analysis of the screen is as follows: the sequences flanking retroviral insertion sites were determined using inverse PCR followed by Illumina sequencing ...