Labshake search
Citations for Illumina :
551 - 600 of 9681 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... bidentatus DNA extraction and library preparation was performed by Dovetail Genomics (Scotts Valley, CA, USA) with the TruSeq DNA PCR-Free kit (Trueq Index 5, Illumina, San Diego, CA, USA, mean size 475bp). 150 bp paired-end sequencing was performed on one lane of HiSeqX by Novogene (Cambridge ...
-
bioRxiv - Microbiology 2019Quote: ... The remaining contigs were amplified by PCR from the plasmid preparations that followed two iterations of SpyCas9 selection (those used in PCRs for Illumina library construction). PCR primers (table S6 ...
-
bioRxiv - Genomics 2020Quote: The accuracy of variant detection by ONT sequencing was evaluated by comparison to the set of variants identified by Illumina sequencing in matched cases ...
-
bioRxiv - Genetics 2020Quote: ... The first PCR used universal primers (without Illumina indexes) to amplify the barcodes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The 100 PCR samples were then sequenced by Illumina sequencing platform ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free), sequencing and quality checks were done by the Biomics sequencing platform of the Institut Pasteur (C2RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR amplification using Illumina sequencing adaptor primers (Illumina). Paired-end sequencing was performed on a Hi-Seq 2500 System (University of Georgia Genomics Core ...
-
bioRxiv - Microbiology 2022Quote: ... Library preparation (Illumina® TruSeq™ DNA PCR-Free) and sequencing was done on the C2RT Biomics platform of the Institut Pasteur (using short reads ...
-
bioRxiv - Neuroscience 2019Quote: ... the amplification (cDNA and PCR) and sequencing primers (Illumina) and the low-quality bases were removed using Trimmomatic 0.35 software 63 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Clones were screened by PCR and Miseq sequencing (Illumina).
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR amplicons were purified and sequenced (NextSeq 500, Illumina). Screens were analyzed using Python (v.2.7.13) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplification followed Earth Microbiome Project recommendations (“16S Illumina Amplicon Protocol ...
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were barcoded and sequenced utilizing MiSeq (Illumina) Nano kit v.2 as described in [84].
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were sequenced with a MiSeq (Illumina) using the reagent kit v3 (PE 2x300 ...
-
bioRxiv - Microbiology 2024Quote: ... which was determined by PCR and confirmed by Illumina whole-genome sequencing for this study.
-
bioRxiv - Cancer Biology 2022Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [56] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Genomics 2023Quote: ... (2022) (TruSeq DNA PCR-free libraries sequenced on Illumina NovaSeq6000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified PCR products were sequenced using HiSeq 2500 (Illumina). Bowtie [82] was used to align the sequenced reads to the sgRNA library ...
-
bioRxiv - Genetics 2023Quote: ... using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermofisher Scientific) ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR-free TruSeq DNA (Illumina, San Diego, CA) was used to prepare a library ...
-
bioRxiv - Cell Biology 2023Quote: ... purified transposed DNA was PCR amplified using Nextera (Illumina) i5 common adapter and unique i7 index adapters and NEBNext High Fidelity 2x PCR Master Mix for 5 cycles with the following program ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were prepared using TruSeq DNA PCR-Free (Illumina) and were sequenced with 150-base-pair paired end reads on an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse and forward amplicon PCR primers recommended by Illumina were used (16s Amplicon PCR Forward Primer= TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG ...
-
bioRxiv - Cell Biology 2021Quote: ... The libraries were quantified by RT-qPCR and sequenced in paired-end mode (2x75 bp) with NextSeq 500 (Illumina, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... the samples were subjected to library RT and amplification to tag the RNA molecules with specific and unique sample indexes (Illumina), followed by a final beads cleanup (1:0.8 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the samples were subjected to library RT and amplification to tag the RNA molecules with specific and unique sample indexes (Illumina), followed by a final beads cleanup (1:0.8 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR-amplified cDNA was purified using AMPure XP beads and processed with the Nextera XT DNA Library Preparation Kits (Illumina, Cat. # FC-131-1024 and FC-131-1096) as per the protocol provided by the manufacturer.
-
bioRxiv - Genomics 2020Quote: ... RNAseq was performed during wheat infection time-course using strand-specific RNA-libraries from Illumina HISeq2500 sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... The virus was passaged three times in VeroE6 cells and genotype sequence confirmed by Illumina sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... Indexed libraries were pooled and sequenced three – four times on a Next-Seq 500 (Illumina) with sequencing parameters as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... from islets was added to 50 μM first-strand RT primer (the sequence at the 5’ portion corresponds to primer P7 on the Illumina flowcell), 10 mM dNTP mix ...
-
bioRxiv - Genetics 2021Quote: ... DNA was PCR-amplified with TruSeq dual indexing primers (Illumina) to generate Illumina compatible libraries ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by tailed-PCR using Nextera XT Index Primers (Illumina) (S1B Fig) ...
-
bioRxiv - Genomics 2019Quote: ... After a post-capture PCR (four amplification cycles using Illumina PE PCR 1.0 and PE PCR 2.0 primers ...
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were then quantified and sequenced using MiSeq (Illumina).
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification was performed in a 48 well plate (Illumina) on an Eco machine (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR amplicons were then sequenced on a NextSeq 500 (Illumina). Guide scores were calculated as median log2 fold change in the abundance between the initial and final population of that sgRNA similar to standard CRISPR screens ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary PCR was performed using Nextra XT index primers (Illumina). The secondary PCR condition was 95 °C (20 sec) ...
-
bioRxiv - Cell Biology 2019Quote: ... The PCR-amplified samples were sequenced on a HiSeq2500 (Illumina) at the Biomedical Sequencing Facility (CeMM/MUW).
-
bioRxiv - Cell Biology 2022Quote: ... PCR amplicons were purified and sequenced on a MiSeq (Illumina). Sequencing reads were mapped and the abundance of each sgRNA was measured ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were sequenced on a HiSeq 4000 instrument (Illumina) at 50bp reads to a depth of 30M reads per sample.
-
bioRxiv - Microbiology 2023Quote: ... PCR-enriched and barcoded with unique dual indexes (Illumina, 20027213) using six PCR cycles ...
-
bioRxiv - Microbiology 2022Quote: ... Purified PCR products were then sequenced on a HiSeq400 (Illumina) with single end 100 bp reads at a minimum read depth of 5 million reads/sample.
-
bioRxiv - Cell Biology 2023Quote: ... Amplified and gel purified PCR products were sequenced by Illumina HiSeq (Azenta) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by PCR amplification using TruSeq-designed primers from Illumina guidelines ...
-
bioRxiv - Genetics 2024Quote: ... PCR products of different loci were pooled and sequenced (Illumina NovaSeq 2 × 250 bp ...