Labshake search
Citations for Illumina :
551 - 600 of 9201 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Reverse and forward amplicon PCR primers recommended by Illumina were used (16s Amplicon PCR Forward Primer= TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG ...
-
bioRxiv - Genetics 2023Quote: ... using PCR primers ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCAGAAGCAGCTCGACGC and GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCAGCTGCCGGAAGTGCT (Illumina adapters underlined) and Phire DNA polymerase (Thermofisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: Libraries were prepared using TruSeq DNA PCR-Free (Illumina) and were sequenced with 150-base-pair paired end reads on an Illumina HiSeq 4000 ...
-
bioRxiv - Cell Biology 2023Quote: ... purified transposed DNA was PCR amplified using Nextera (Illumina) i5 common adapter and unique i7 index adapters and NEBNext High Fidelity 2x PCR Master Mix for 5 cycles with the following program ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR-free TruSeq DNA (Illumina, San Diego, CA) was used to prepare a library ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were sequenced with a MiSeq (Illumina) using the reagent kit v3 (PE 2x300 ...
-
bioRxiv - Microbiology 2024Quote: ... which was determined by PCR and confirmed by Illumina whole-genome sequencing for this study.
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR-amplified cDNA was purified using AMPure XP beads and processed with the Nextera XT DNA Library Preparation Kits (Illumina, Cat. # FC-131-1024 and FC-131-1096) as per the protocol provided by the manufacturer.
-
bioRxiv - Genomics 2020Quote: ... RNAseq was performed during wheat infection time-course using strand-specific RNA-libraries from Illumina HISeq2500 sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... The virus was passaged three times in VeroE6 cells and genotype sequence confirmed by Illumina sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... Indexed libraries were pooled and sequenced three – four times on a Next-Seq 500 (Illumina) with sequencing parameters as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... from islets was added to 50 μM first-strand RT primer (the sequence at the 5’ portion corresponds to primer P7 on the Illumina flowcell), 10 mM dNTP mix ...
-
bioRxiv - Genetics 2021Quote: ... DNA was PCR-amplified with TruSeq dual indexing primers (Illumina) to generate Illumina compatible libraries ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by tailed-PCR using Nextera XT Index Primers (Illumina) (S1B Fig) ...
-
bioRxiv - Genomics 2019Quote: ... After a post-capture PCR (four amplification cycles using Illumina PE PCR 1.0 and PE PCR 2.0 primers ...
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were then quantified and sequenced using MiSeq (Illumina).
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification was performed in a 48 well plate (Illumina) on an Eco machine (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR amplicons were then sequenced on a NextSeq 500 (Illumina). Guide scores were calculated as median log2 fold change in the abundance between the initial and final population of that sgRNA similar to standard CRISPR screens ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary PCR was performed using Nextra XT index primers (Illumina). The secondary PCR condition was 95 °C (20 sec) ...
-
bioRxiv - Cell Biology 2019Quote: ... The PCR-amplified samples were sequenced on a HiSeq2500 (Illumina) at the Biomedical Sequencing Facility (CeMM/MUW).
-
bioRxiv - Cell Biology 2022Quote: ... PCR amplicons were purified and sequenced on a MiSeq (Illumina). Sequencing reads were mapped and the abundance of each sgRNA was measured ...
-
bioRxiv - Microbiology 2022Quote: ... Purified PCR products were then sequenced on a HiSeq400 (Illumina) with single end 100 bp reads at a minimum read depth of 5 million reads/sample.
-
bioRxiv - Cell Biology 2023Quote: ... Amplified and gel purified PCR products were sequenced by Illumina HiSeq (Azenta) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR-enriched and barcoded with unique dual indexes (Illumina, 20027213) using six PCR cycles ...
-
bioRxiv - Microbiology 2023Quote: ... followed by PCR amplification using TruSeq-designed primers from Illumina guidelines ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were sequenced on a HiSeq 4000 instrument (Illumina) at 50bp reads to a depth of 30M reads per sample.
-
bioRxiv - Genomics 2019Quote: ... multiplexed (10 samples at a time) and sequenced as paired-end reads on the MiSeq (Illumina) platform at the BecA-ILRI hub.
-
bioRxiv - Genomics 2020Quote: ... sequencing reads were mapped to reference viral genome sequence and consensus sequence for each sample was built using Dragen RNA pathogen detection software (version 9) in BaseSpace (Illumina Inc, USA). For amplified whole-genome sequencing ...
-
bioRxiv - Genomics 2021Quote: ... We polished the resulting assemblies once with Quiver using PacBio reads (SMRT Analysis v2.3.0; [125] and ten times with Pilon v1.22 [126] using raw Illumina reads with parameters “--mindepth 3 --minmq 10 --fix bases”.
-
bioRxiv - Microbiology 2020Quote: ... and TruSeq Index PCR Primer barcodes (Illumina, San Diego, CA, USA) were used to prepare and index each individual library ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR samples contained 11.2 μL of KAPA polymerase mix (Illumina), 4.4 μL each of the 5 μM column and row indexing primers ...
-
bioRxiv - Immunology 2021Quote: ... and indexed TruSeq Small RNA PCR primers (Illumina, San Diego, CA) as specified(Stoeckius et al. ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... following manufacturers instructions and TruSeq DNA PCR-Free Library (Illumina, USA) sequencing libraries were prepared after quality control ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were PCR-purified and sequenced on a HiSeq2500 machine (Illumina) generating 50 base pair (bp ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... and indexed TruSeq Small RNA PCR primers (Illumina, San Diego, CA) as specified(13) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and prepared individually tagged 100bp “TruSeq DNA PCR-free” libraries (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... PCR amplicons were gel purified and sequenced on a HiSeq4000 (Illumina) to obtain about 30 million reads for each samples ...
-
bioRxiv - Systems Biology 2021Quote: ... and libraries were amplified by PCR with barcoded Nextera primers (Illumina) using 2X NEBNext High-Fidelity PCR Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified PCR products were amplified using indexed adapter primers from Illumina to generate barcoded amplicons and NEBNext Ultra II Q5 Master Mix (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... The variable sequence was PCR-amplified and sequenced (Illumina HiSeq 4000) to verify clone representation of all library component ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1 ...
-
bioRxiv - Molecular Biology 2022Quote: Cell lysate was PCR amplified with genomic primers flanked by Illumina adaptor overhang to generate approximately 300 base products ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library fragments were amplified using standard PCR and Nextera primers (Illumina) by adding 25 μl of 2x NEBnext master mix ...
-
bioRxiv - Microbiology 2023Quote: ... library tagmentation and 16-cycle PCR amplification using Nextera XT (Illumina), and 150 bp paired-end sequencing using an Illumina MiSeq or NextSeq.
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were sequenced on a HiSeq 2000 sequencing platform (Illumina). A fraction of the sgRNA plasmid library was also sequenced to determine the sgRNA distribution in the input material ...
-
bioRxiv - Biophysics 2022Quote: ... and amplicons were generated by PCR for amplicon sequencing by Illumina 2×300 paired-end sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplicons surrounding Usp18 sgRNA cut sites were sequenced (MiSeq, Illumina) and frame-shift mutation frequency for triploid CT26 cells was estimated to be ∼65% by the following equation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...