Labshake search
Citations for Illumina :
551 - 600 of 2584 citations for 9 10 Dihydro 4H benzo 4 5 cyclohepta 1 2 b thiophen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The uniquely barcoded libraries were multiplexed onto one lane and 100-bp paired-end deep sequencing was carried out at the HiSeq 4000 (Illumina) generating ∼20 million reads per sample.
-
bioRxiv - Molecular Biology 2023Quote: ... we used one lane of a NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles) (Illumina, San Diego, CA, USA, 20028401) (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: ... The final clone was confirmed to have two copies or the DNMT3AR882H allele and one copy of the DNMT3AWT allele by Illumina amplicon sequencing (Figure S1).
-
bioRxiv - Plant Biology 2023Quote: Prepared libraries were pooled and diluted to 6 pM for TruSeq Paired End v4 DNA clustering on one single flow cell lane using a cBot device (Illumina). Final sequencing was carried out on an Illumina HiSeq 2500 platform using 126 ...
-
bioRxiv - Genomics 2023Quote: ... Each pool of libraries was sequenced independently by method on one lane of a NovaSeq6000 S Prime (SP) flowcell (Illumina), for three SP lanes in total ...
-
bioRxiv - Genomics 2023Quote: ... The resulting sequencing libraries were sequenced using the MiSeq system (Illumina v.2 kit, 2 × 150 bp).
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... P2 100 cycles (Read1-28; Read2-90; Index1-10; Index2-10) (Illumina, cat no. 20046811). Cell Ranger version 6 and version 7.1 (for batch 1 and batch 2 respectively ...
-
bioRxiv - Genetics 2020Quote: ... A genome-wide analysis genotyping scan was performed in all six members of family A and in the proband of family B using the HumanCytoSNP-12 DNA Analysis BeadChip Kit (Illumina, San Diego), according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... A sequencing library for the V3-V4 regions of the 16S rRNA gene was prepared according to a modified version of the instructions provided by the manufacturer (Part # 15044223 Rev. B; Illumina Inc., USA) with some modifications46 and sequenced using the Illumina Miseq System (Illumina Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared from 600ng of total RNA using the TruSeq® Stranded mRNA Library Prep kit and the TruSeq® RNA Single Indexes kits A and B from Illumina. The library quality and quantity were checked using an Agilent 2100 Bioanalyzer and a Qubit dsDNA HS Assay Kit ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Plant Biology 2019Quote: ... The Hi-C libraries were sent to the Australian Genome Research Facility (Melbourne, Australia) for sequencing using one lane of 100 bp PE sequencing using a HiSeq2000 (Illumina Inc.).
-
bioRxiv - Plant Biology 2021Quote: One microgram of total RNA was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Prep Kit (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... a total of 2.58 × 108 assembled paired-end reads was obtained as two 33 Gb FastQ files (one file per Illumina-sequence lane). The sequence quality was evaluated by means of the FastQc software (Andrews ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Paired-end sequencing with 150 cycles for each side of the fragments was performed in one lane of the MiSeq® System (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... parental DNA was extracted from one individual male and female from tail-fin clip and sequencing library were synthesized with Nextera XT Kit (Illumina, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The short-read paired-end libraries were sequenced in two independent lanes and the mate-pair library in one lane using the Illumina HiSeq4000 platform (Illumina, USA). The library’s construction and sequencing were performed by Hokkaido System Science Co ...
-
bioRxiv - Genomics 2021Quote: Microarray-derived SNP genotypes were available for 30,499 BSW cattle typed on seven low-density (20k-150k) and one high-density chip (Illumina BovineHD; 777k). Coordinates of the SNP were originally determined according to the ARS-UCD1.2 build ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then barcoded and pooled into two lanes (eight samples in one and two in another) to generate 100bp paired-end reads on the HiSeq1500 sequencer (Illumina, Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... We pooled up to 12 samples (with different barcodes) in one lane of a flow cell for sequencing (Illumina HiSeq 2500) and used a 150 bp paired-end read configuration ...
-
bioRxiv - Genomics 2022Quote: ... The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com) for one lane of PE150 Illumina HiSeq X-Ten (Illumina, San Diego, CA, USA) sequencing.
-
bioRxiv - Genomics 2022Quote: ... These products were then used for index PCR using the SI-PCR Primer from the 10X kit for the i5 and one of the small RNA TrueSeq index primers for the i7 (Illumina #15004197).
-
bioRxiv - Evolutionary Biology 2023Quote: ... We then sequenced the entire pooled library on one lane of a NovaSeq6000 SP flowcell (2x150bp; Illumina, Inc. San Diego, CA) at the University of Iowa Institute of Human Genetics.
-
bioRxiv - Genomics 2023Quote: ... Libraries were pooled and sequenced (2x150nt) on one lane of a S1 flowcell on the NovaSeq 6000 (Illumina, San Diego, CA). FastQ files were generated and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina).
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added to the pooled amplicon library prior to running the sample on a Miseq Sequencer System (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added to the pooled amplicon library prior to running the sample on an Miseq Sequencer System (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added to the pooled amplicon library prior to running the sample on an Miseq Sequencer System (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added prior to running the sample on an Miseq Sequencer System (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... adding 10% PhiX spike-in (Illumina).